From 8a4e21805d54be0adb784d6f33daf3f3f536bcb4 Mon Sep 17 00:00:00 2001 From: clintval Date: Tue, 24 Dec 2024 15:19:44 -0500 Subject: [PATCH 01/36] Add a function for determining read pair orientation --- fgpyo/sam/__init__.py | 116 ++++++++++++++++++++- tests/fgpyo/sam/test_sam.py | 196 ++++++++++++++++++++++++++++++++++++ 2 files changed, 307 insertions(+), 5 deletions(-) diff --git a/fgpyo/sam/__init__.py b/fgpyo/sam/__init__.py index c78dd651..0bb90e3c 100644 --- a/fgpyo/sam/__init__.py +++ b/fgpyo/sam/__init__.py @@ -265,7 +265,8 @@ def _pysam_open( assert file_type is not None, "Must specify file_type when writing to standard output" path = sys.stdout else: - file_type = file_type or SamFileType.from_path(path) + if file_type is None: + file_type = SamFileType.from_path(path) path = str(path) elif not isinstance(path, _IOClasses): # type: ignore[unreachable] open_type = "reading" if open_for_reading else "writing" @@ -606,6 +607,111 @@ def __getitem__( return self.elements[index] +@enum.unique +class PairOrientation(enum.Enum): + """Enumerations of read pair orientations.""" + + FR = "FR" + """A pair orientation for forward-reverse reads ("innie").""" + + RF = "RF" + """A pair orientation for reverse-forward reads ("outie").""" + + TANDEM = "TANDEM" + """A pair orientation for tandem (forward-forward or reverse-reverse) reads.""" + + @classmethod + def build( + cls, r1: AlignedSegment, r2: Optional[AlignedSegment] = None + ) -> Optional["PairOrientation"]: + """Returns the pair orientation if both reads are mapped to the same reference sequence. + + + Args: + r1: The first read in the template. + r2: The second read in the template. If undefined, mate data on R1 will be used. + + See: + - https://github.com/samtools/htsjdk/blob/c31bc92c24bc4e9552b2a913e52286edf8f8ab96/src/main/java/htsjdk/samtools/SamPairUtil.java#L71-L102 + """ + + if r2 is None: + r2_is_unmapped = r1.mate_is_unmapped + r2_reference_id = r1.next_reference_id + else: + r2_is_unmapped = r2.is_unmapped + r2_reference_id = r2.reference_id + + if r1.is_unmapped or r2_is_unmapped or r1.reference_id != r2_reference_id: + return None + + if r2 is None: + if not r1.has_tag("MC"): + raise ValueError('Cannot determine proper pair status without R2\'s cigar ("MC")!') + r2_cigar = Cigar.from_cigarstring(str(r1.get_tag("MC"))) + r2_is_forward = r1.mate_is_forward + r2_reference_start = r1.next_reference_start + r2_reference_end = r1.next_reference_start + r2_cigar.length_on_target() + else: + r2_is_forward = r2.is_forward + r2_reference_start = r2.reference_start + r2_reference_end = r2.reference_end + + if r1.is_forward is r2_is_forward: + return PairOrientation.TANDEM + elif r1.is_forward and r1.reference_start < r2_reference_end: + return PairOrientation.FR + elif r1.is_reverse and r2_reference_start < r1.reference_end: + return PairOrientation.FR + else: + return PairOrientation.RF + + +DefaultProperlyPairedOrientations = {PairOrientation.FR} +"""The default orientations for properly paired reads.""" + + +def properly_paired( + r1: AlignedSegment, + r2: Optional[AlignedSegment] = None, + max_insert_size: int = 1000, + orientations: set[PairOrientation] = DefaultProperlyPairedOrientations, +) -> bool: + """Determines if a read pair is properly paired or not. + + Criteria for reads in a proper pair are: + - Both reads are aligned + - Both reads are aligned to the same reference sequence + - The pair orientation of the reads is a part of the valid pair orientations (default "FR") + - The inferred insert size is not more than a maximum length (default 1000) + + Args: + r1: The first read in the template. + r2: The second read in the template. If undefined, mate data on R1 will be used. + max_insert_size: The maximum insert size to consider a read pair "proper". + orientations: The valid set of orientations to consider a read pair "proper". + + See: + https://github.com/samtools/htsjdk/blob/c31bc92c24bc4e9552b2a913e52286edf8f8ab96/src/main/java/htsjdk/samtools/SamPairUtil.java#L106-L125 + """ + if r2 is None: + r2_is_mapped = r1.mate_is_mapped + r2_reference_id = r1.next_reference_id + else: + r2_is_mapped = r2.is_mapped + r2_reference_id = r2.reference_id + + return ( + r1.is_mapped + and r2_is_mapped + and r1.reference_id == r2_reference_id + and PairOrientation.build(r1, r2) in orientations + # TODO: consider replacing with `abs(isize(r1, r2)) <= max_insert_size` + # which can only be done if isize() is modified to allow for an optional R2. + and 0 < abs(r1.template_length) <= max_insert_size + ) + + @attr.s(frozen=True, auto_attribs=True) class SupplementaryAlignment: """Stores a supplementary alignment record produced by BWA and stored in the SA SAM tag. @@ -706,9 +812,8 @@ def set_pair_info(r1: AlignedSegment, r2: AlignedSegment, proper_pair: bool = Tr r1: read 1 r2: read 2 with the same queryname as r1 """ - assert not r1.is_unmapped, f"Cannot process unmapped mate {r1.query_name}/1" - assert not r2.is_unmapped, f"Cannot process unmapped mate {r2.query_name}/2" - assert r1.query_name == r2.query_name, "Attempting to pair reads with different qnames." + if r1.query_name != r2.query_name: + raise ValueError("Cannot set pair info on reads with different query names!") for r in [r1, r2]: r.is_paired = True @@ -723,8 +828,9 @@ def set_pair_info(r1: AlignedSegment, r2: AlignedSegment, proper_pair: bool = Tr dest.next_reference_id = src.reference_id dest.next_reference_start = src.reference_start dest.mate_is_reverse = src.is_reverse - dest.mate_is_unmapped = False + dest.mate_is_unmapped = src.mate_is_unmapped dest.set_tag("MC", src.cigarstring) + dest.set_tag("MQ", src.mapping_quality) insert_size = isize(r1, r2) r1.template_length = insert_size diff --git a/tests/fgpyo/sam/test_sam.py b/tests/fgpyo/sam/test_sam.py index b2086b66..497a35b5 100755 --- a/tests/fgpyo/sam/test_sam.py +++ b/tests/fgpyo/sam/test_sam.py @@ -17,7 +17,9 @@ from fgpyo.sam import CigarElement from fgpyo.sam import CigarOp from fgpyo.sam import CigarParsingException +from fgpyo.sam import PairOrientation from fgpyo.sam import SamFileType +from fgpyo.sam import properly_paired from fgpyo.sam.builder import SamBuilder @@ -300,6 +302,200 @@ def test_is_clipping() -> None: assert clips == [CigarOp.S, CigarOp.H] +def test_pair_orientation_build_with_r2() -> None: + """Test that we can build all pair orientations with R1 and R2.""" + builder = SamBuilder() + r1, r2 = builder.add_pair(chrom="chr1", start1=100, cigar1="115M", start2=250, cigar2="40M") + assert PairOrientation.build(r1, r2) is PairOrientation.FR + + r1, r2 = builder.add_pair(chrom="chr1", start1=100, cigar1="115M", start2=250, cigar2="40M") + r1.is_forward = False + r2.is_forward = True + sam.set_pair_info(r1, r2) + assert PairOrientation.build(r1, r2) is PairOrientation.RF + + r1, r2 = builder.add_pair(chrom="chr1", start1=100, cigar1="115M", start2=250, cigar2="40M") + r1.is_forward = True + r2.is_forward = True + sam.set_pair_info(r1, r2) + assert PairOrientation.build(r1, r2) is PairOrientation.TANDEM + + r1, r2 = builder.add_pair(chrom="chr1", start1=100, cigar1="115M", start2=250, cigar2="40M") + r1.is_forward = False + r2.is_forward = False + sam.set_pair_info(r1, r2) + assert PairOrientation.build(r1, r2) is PairOrientation.TANDEM + + +def test_pair_orientation_is_fr_if_opposite_directions_and_overlapping() -> None: + """Test the pair orientation is always FR if the reads overlap and are oriented opposite.""" + builder = SamBuilder() + r1, r2 = builder.add_pair(chrom="chr1", start1=100, cigar1="10M", start2=100, cigar2="10M") + assert PairOrientation.build(r1, r2) is PairOrientation.FR + + builder = SamBuilder() + r1, r2 = builder.add_pair(chrom="chr1", start1=100, cigar1="10M", start2=100, cigar2="10M") + r1.is_reverse = True + r2.is_reverse = False + sam.set_pair_info(r1, r2) + assert PairOrientation.build(r1, r2) is PairOrientation.FR + + +def test_pair_orientation_build_with_either_unmapped() -> None: + """Test that we can return None with either R1 and R2 unmapped (or both).""" + builder = SamBuilder() + r1, r2 = builder.add_pair() + assert r1.is_unmapped + assert r2.is_unmapped + assert PairOrientation.build(r1, r2) is None + + r1, r2 = builder.add_pair(chrom="chr1", start1=100) + assert r1.is_mapped + assert r2.is_unmapped + assert PairOrientation.build(r1, r2) is None + + r1, r2 = builder.add_pair(chrom="chr1", start2=100) + assert r1.is_unmapped + assert r2.is_mapped + assert PairOrientation.build(r1, r2) is None + + +def test_pair_orientation_build_with_no_r2_but_r2_mapped() -> None: + """Test that we can build all pair orientations with R1 and no R2, but R2 is mapped.""" + builder = SamBuilder() + r1, r2 = builder.add_pair(chrom="chr1", start1=100, cigar1="115M", start2=250, cigar2="40M") + assert PairOrientation.build(r1) is PairOrientation.FR + + r1, r2 = builder.add_pair(chrom="chr1", start1=100, cigar1="115M", start2=250, cigar2="40M") + r1.is_forward = False + r2.is_forward = True + sam.set_pair_info(r1, r2) + assert PairOrientation.build(r1) is PairOrientation.RF + + r1, r2 = builder.add_pair(chrom="chr1", start1=100, cigar1="115M", start2=250, cigar2="40M") + r1.is_forward = True + r2.is_forward = True + sam.set_pair_info(r1, r2) + assert PairOrientation.build(r1) is PairOrientation.TANDEM + + r1, r2 = builder.add_pair(chrom="chr1", start1=100, cigar1="115M", start2=250, cigar2="40M") + r1.is_forward = False + r2.is_forward = False + sam.set_pair_info(r1, r2) + assert PairOrientation.build(r1) is PairOrientation.TANDEM + + +def test_pair_orientation_build_with_either_unmapped_but_no_r2() -> None: + """Test that we can return None with either R1 and R2 unmapped (or both), but no R2.""" + builder = SamBuilder() + r1, r2 = builder.add_pair() + assert r1.is_unmapped + assert r2.is_unmapped + sam.set_pair_info(r1, r2) + assert PairOrientation.build(r1) is None + + r1, r2 = builder.add_pair(chrom="chr1", start1=100) + assert r1.is_mapped + assert r2.is_unmapped + sam.set_pair_info(r1, r2) + assert PairOrientation.build(r1) is None + + r1, r2 = builder.add_pair(chrom="chr1", start2=100) + assert r1.is_unmapped + assert r2.is_mapped + sam.set_pair_info(r1, r2) + assert PairOrientation.build(r1) is None + + +def test_pair_orientation_build_raises_if_it_cant_find_mate_cigar_tag() -> None: + """Test that an exception is raised if we cannot find the mate cigar tag.""" + builder = SamBuilder() + r1, r2 = builder.add_pair(chrom="chr1", start1=10, start2=30) + sam.set_pair_info(r1, r2) + r1.set_tag("MC", None) # Clear out the MC tag. + + with pytest.raises(ValueError): + PairOrientation.build(r1) + + +def test_properly_paired_when_actually_proper() -> None: + """Test that properly_paired returns True when reads are properly paired.""" + builder = SamBuilder() + r1, r2 = builder.add_pair(chrom="chr1", start1=100, cigar1="115M", start2=250, cigar2="40M") + assert properly_paired(r1, r2) + + r1, r2 = builder.add_pair(chrom="chr1", start1=100, cigar1="10M", start2=100, cigar2="10M") + r1.is_reverse = True + r2.is_reverse = False + sam.set_pair_info(r1, r2) + assert properly_paired(r1, r2) + + +def test_properly_paired_when_actually_proper_and_no_r2() -> None: + """Test that properly_paired returns True when reads are properly paired, but no R2.""" + builder = SamBuilder() + r1, r2 = builder.add_pair(chrom="chr1", start1=100, cigar1="115M", start2=250, cigar2="40M") + assert properly_paired(r1) + + r1, r2 = builder.add_pair(chrom="chr1", start1=100, cigar1="10M", start2=100, cigar2="10M") + r1.is_reverse = True + r2.is_reverse = False + sam.set_pair_info(r1, r2) + assert properly_paired(r1) + + +def test_not_properly_paired_if_wrong_orientation() -> None: + """Test that reads are not properly paired if they are not in the right orientation.""" + builder = SamBuilder() + r1, r2 = builder.add_pair(chrom="chr1", start1=100, cigar1="115M", start2=250, cigar2="40M") + r1.is_forward = False + r2.is_forward = True + sam.set_pair_info(r1, r2) + assert not properly_paired(r1, r2) + + r1, r2 = builder.add_pair(chrom="chr1", start1=100, cigar1="115M", start2=250, cigar2="40M") + r1.is_forward = True + r2.is_forward = True + sam.set_pair_info(r1, r2) + assert not properly_paired(r1, r2) + + r1, r2 = builder.add_pair(chrom="chr1", start1=100, cigar1="115M", start2=250, cigar2="40M") + r1.is_forward = False + r2.is_forward = False + sam.set_pair_info(r1, r2) + assert not properly_paired(r1, r2) + + +def test_not_properly_paired_if_wrong_orientation_and_no_r2() -> None: + """Test reads are not properly paired if they are not in the right orientation, but no R2.""" + builder = SamBuilder() + r1, r2 = builder.add_pair(chrom="chr1", start1=100, cigar1="115M", start2=250, cigar2="40M") + r1.is_forward = False + r2.is_forward = True + sam.set_pair_info(r1, r2) + assert not properly_paired(r1) + + r1, r2 = builder.add_pair(chrom="chr1", start1=100, cigar1="115M", start2=250, cigar2="40M") + r1.is_forward = True + r2.is_forward = True + sam.set_pair_info(r1, r2) + assert not properly_paired(r1) + + r1, r2 = builder.add_pair(chrom="chr1", start1=100, cigar1="115M", start2=250, cigar2="40M") + r1.is_forward = False + r2.is_forward = False + sam.set_pair_info(r1, r2) + assert not properly_paired(r1) + + +def test_not_properly_paired_if_too_far_apart() -> None: + """Test that reads are not properly paired if they are too far apart.""" + builder = SamBuilder() + r1, r2 = builder.add_pair(chrom="chr1", start1=100, start2=100 + 1000) + sam.set_pair_info(r1, r2) + assert not properly_paired(r1, r2) + + def test_isize() -> None: builder = SamBuilder() r1, r2 = builder.add_pair(chrom="chr1", start1=100, cigar1="115M", start2=250, cigar2="40M") From cb734da9b50df048186cb0396f0106df4c0b3e81 Mon Sep 17 00:00:00 2001 From: clintval Date: Tue, 24 Dec 2024 15:34:16 -0500 Subject: [PATCH 02/36] chore: remove a newline --- fgpyo/sam/__init__.py | 1 - 1 file changed, 1 deletion(-) diff --git a/fgpyo/sam/__init__.py b/fgpyo/sam/__init__.py index 0bb90e3c..d2e6c5cf 100644 --- a/fgpyo/sam/__init__.py +++ b/fgpyo/sam/__init__.py @@ -626,7 +626,6 @@ def build( ) -> Optional["PairOrientation"]: """Returns the pair orientation if both reads are mapped to the same reference sequence. - Args: r1: The first read in the template. r2: The second read in the template. If undefined, mate data on R1 will be used. From 3dd8bc485d35ed8ced46dccc29dd3a899ad09578 Mon Sep 17 00:00:00 2001 From: clintval Date: Tue, 24 Dec 2024 15:35:14 -0500 Subject: [PATCH 03/36] docs: tweak an arg description --- fgpyo/sam/__init__.py | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/fgpyo/sam/__init__.py b/fgpyo/sam/__init__.py index d2e6c5cf..0e832f95 100644 --- a/fgpyo/sam/__init__.py +++ b/fgpyo/sam/__init__.py @@ -628,7 +628,7 @@ def build( Args: r1: The first read in the template. - r2: The second read in the template. If undefined, mate data on R1 will be used. + r2: The second read in the template. If undefined, mate data set upon R1 will be used. See: - https://github.com/samtools/htsjdk/blob/c31bc92c24bc4e9552b2a913e52286edf8f8ab96/src/main/java/htsjdk/samtools/SamPairUtil.java#L71-L102 @@ -686,7 +686,7 @@ def properly_paired( Args: r1: The first read in the template. - r2: The second read in the template. If undefined, mate data on R1 will be used. + r2: The second read in the template. If undefined, mate data set upon R1 will be used. max_insert_size: The maximum insert size to consider a read pair "proper". orientations: The valid set of orientations to consider a read pair "proper". From e4d076d36831c42d5a479a35b973bc1464f33cdf Mon Sep 17 00:00:00 2001 From: clintval Date: Tue, 24 Dec 2024 15:39:03 -0500 Subject: [PATCH 04/36] docs: make hyperlinks for makedocs --- fgpyo/sam/__init__.py | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/fgpyo/sam/__init__.py b/fgpyo/sam/__init__.py index 0e832f95..454ed126 100644 --- a/fgpyo/sam/__init__.py +++ b/fgpyo/sam/__init__.py @@ -631,7 +631,7 @@ def build( r2: The second read in the template. If undefined, mate data set upon R1 will be used. See: - - https://github.com/samtools/htsjdk/blob/c31bc92c24bc4e9552b2a913e52286edf8f8ab96/src/main/java/htsjdk/samtools/SamPairUtil.java#L71-L102 + [`htsjdk.samtools.SamPairUtil.getPairOrientation()`](https://github.com/samtools/htsjdk/blob/c31bc92c24bc4e9552b2a913e52286edf8f8ab96/src/main/java/htsjdk/samtools/SamPairUtil.java#L71-L102) """ if r2 is None: @@ -691,7 +691,7 @@ def properly_paired( orientations: The valid set of orientations to consider a read pair "proper". See: - https://github.com/samtools/htsjdk/blob/c31bc92c24bc4e9552b2a913e52286edf8f8ab96/src/main/java/htsjdk/samtools/SamPairUtil.java#L106-L125 + [`htsjdk.samtools.SamPairUtil.isProperPair()`](https://github.com/samtools/htsjdk/blob/c31bc92c24bc4e9552b2a913e52286edf8f8ab96/src/main/java/htsjdk/samtools/SamPairUtil.java#L106-L125) """ if r2 is None: r2_is_mapped = r1.mate_is_mapped From 4ee5878ef9933a2a086c9eb12cd4f3ca5da5a6cd Mon Sep 17 00:00:00 2001 From: clintval Date: Thu, 26 Dec 2024 20:28:31 -0500 Subject: [PATCH 05/36] chore: update name of fn to is_properly_paired --- fgpyo/sam/__init__.py | 2 +- tests/fgpyo/sam/test_sam.py | 38 ++++++++++++++++++------------------- 2 files changed, 20 insertions(+), 20 deletions(-) diff --git a/fgpyo/sam/__init__.py b/fgpyo/sam/__init__.py index 454ed126..9cf9466b 100644 --- a/fgpyo/sam/__init__.py +++ b/fgpyo/sam/__init__.py @@ -670,7 +670,7 @@ def build( """The default orientations for properly paired reads.""" -def properly_paired( +def is_properly_paired( r1: AlignedSegment, r2: Optional[AlignedSegment] = None, max_insert_size: int = 1000, diff --git a/tests/fgpyo/sam/test_sam.py b/tests/fgpyo/sam/test_sam.py index 497a35b5..dca3bb33 100755 --- a/tests/fgpyo/sam/test_sam.py +++ b/tests/fgpyo/sam/test_sam.py @@ -19,7 +19,7 @@ from fgpyo.sam import CigarParsingException from fgpyo.sam import PairOrientation from fgpyo.sam import SamFileType -from fgpyo.sam import properly_paired +from fgpyo.sam import is_properly_paired from fgpyo.sam.builder import SamBuilder @@ -418,82 +418,82 @@ def test_pair_orientation_build_raises_if_it_cant_find_mate_cigar_tag() -> None: PairOrientation.build(r1) -def test_properly_paired_when_actually_proper() -> None: - """Test that properly_paired returns True when reads are properly paired.""" +def test_is_properly_paired_when_actually_proper() -> None: + """Test that is_properly_paired returns True when reads are properly paired.""" builder = SamBuilder() r1, r2 = builder.add_pair(chrom="chr1", start1=100, cigar1="115M", start2=250, cigar2="40M") - assert properly_paired(r1, r2) + assert is_properly_paired(r1, r2) r1, r2 = builder.add_pair(chrom="chr1", start1=100, cigar1="10M", start2=100, cigar2="10M") r1.is_reverse = True r2.is_reverse = False sam.set_pair_info(r1, r2) - assert properly_paired(r1, r2) + assert is_properly_paired(r1, r2) -def test_properly_paired_when_actually_proper_and_no_r2() -> None: - """Test that properly_paired returns True when reads are properly paired, but no R2.""" +def test_is_properly_paired_when_actually_proper_and_no_r2() -> None: + """Test that is_properly_paired returns True when reads are properly paired, but no R2.""" builder = SamBuilder() r1, r2 = builder.add_pair(chrom="chr1", start1=100, cigar1="115M", start2=250, cigar2="40M") - assert properly_paired(r1) + assert is_properly_paired(r1) r1, r2 = builder.add_pair(chrom="chr1", start1=100, cigar1="10M", start2=100, cigar2="10M") r1.is_reverse = True r2.is_reverse = False sam.set_pair_info(r1, r2) - assert properly_paired(r1) + assert is_properly_paired(r1) -def test_not_properly_paired_if_wrong_orientation() -> None: +def test_not_is_properly_paired_if_wrong_orientation() -> None: """Test that reads are not properly paired if they are not in the right orientation.""" builder = SamBuilder() r1, r2 = builder.add_pair(chrom="chr1", start1=100, cigar1="115M", start2=250, cigar2="40M") r1.is_forward = False r2.is_forward = True sam.set_pair_info(r1, r2) - assert not properly_paired(r1, r2) + assert not is_properly_paired(r1, r2) r1, r2 = builder.add_pair(chrom="chr1", start1=100, cigar1="115M", start2=250, cigar2="40M") r1.is_forward = True r2.is_forward = True sam.set_pair_info(r1, r2) - assert not properly_paired(r1, r2) + assert not is_properly_paired(r1, r2) r1, r2 = builder.add_pair(chrom="chr1", start1=100, cigar1="115M", start2=250, cigar2="40M") r1.is_forward = False r2.is_forward = False sam.set_pair_info(r1, r2) - assert not properly_paired(r1, r2) + assert not is_properly_paired(r1, r2) -def test_not_properly_paired_if_wrong_orientation_and_no_r2() -> None: +def test_not_is_properly_paired_if_wrong_orientation_and_no_r2() -> None: """Test reads are not properly paired if they are not in the right orientation, but no R2.""" builder = SamBuilder() r1, r2 = builder.add_pair(chrom="chr1", start1=100, cigar1="115M", start2=250, cigar2="40M") r1.is_forward = False r2.is_forward = True sam.set_pair_info(r1, r2) - assert not properly_paired(r1) + assert not is_properly_paired(r1) r1, r2 = builder.add_pair(chrom="chr1", start1=100, cigar1="115M", start2=250, cigar2="40M") r1.is_forward = True r2.is_forward = True sam.set_pair_info(r1, r2) - assert not properly_paired(r1) + assert not is_properly_paired(r1) r1, r2 = builder.add_pair(chrom="chr1", start1=100, cigar1="115M", start2=250, cigar2="40M") r1.is_forward = False r2.is_forward = False sam.set_pair_info(r1, r2) - assert not properly_paired(r1) + assert not is_properly_paired(r1) -def test_not_properly_paired_if_too_far_apart() -> None: +def test_not_is_properly_paired_if_too_far_apart() -> None: """Test that reads are not properly paired if they are too far apart.""" builder = SamBuilder() r1, r2 = builder.add_pair(chrom="chr1", start1=100, start2=100 + 1000) sam.set_pair_info(r1, r2) - assert not properly_paired(r1, r2) + assert not is_properly_paired(r1, r2) def test_isize() -> None: From 8bca675e3416b65d1121325b118f168934e2ed22 Mon Sep 17 00:00:00 2001 From: clintval Date: Thu, 26 Dec 2024 21:46:17 -0500 Subject: [PATCH 06/36] chore: update name of fn to is_proper_pair --- fgpyo/sam/__init__.py | 2 +- tests/fgpyo/sam/test_sam.py | 38 ++++++++++++++++++------------------- 2 files changed, 20 insertions(+), 20 deletions(-) diff --git a/fgpyo/sam/__init__.py b/fgpyo/sam/__init__.py index 9cf9466b..f5c7404a 100644 --- a/fgpyo/sam/__init__.py +++ b/fgpyo/sam/__init__.py @@ -670,7 +670,7 @@ def build( """The default orientations for properly paired reads.""" -def is_properly_paired( +def is_proper_pair( r1: AlignedSegment, r2: Optional[AlignedSegment] = None, max_insert_size: int = 1000, diff --git a/tests/fgpyo/sam/test_sam.py b/tests/fgpyo/sam/test_sam.py index dca3bb33..5ac6639b 100755 --- a/tests/fgpyo/sam/test_sam.py +++ b/tests/fgpyo/sam/test_sam.py @@ -19,7 +19,7 @@ from fgpyo.sam import CigarParsingException from fgpyo.sam import PairOrientation from fgpyo.sam import SamFileType -from fgpyo.sam import is_properly_paired +from fgpyo.sam import is_proper_pair from fgpyo.sam.builder import SamBuilder @@ -418,82 +418,82 @@ def test_pair_orientation_build_raises_if_it_cant_find_mate_cigar_tag() -> None: PairOrientation.build(r1) -def test_is_properly_paired_when_actually_proper() -> None: - """Test that is_properly_paired returns True when reads are properly paired.""" +def test_is_proper_pair_when_actually_proper() -> None: + """Test that is_proper_pair returns True when reads are properly paired.""" builder = SamBuilder() r1, r2 = builder.add_pair(chrom="chr1", start1=100, cigar1="115M", start2=250, cigar2="40M") - assert is_properly_paired(r1, r2) + assert is_proper_pair(r1, r2) r1, r2 = builder.add_pair(chrom="chr1", start1=100, cigar1="10M", start2=100, cigar2="10M") r1.is_reverse = True r2.is_reverse = False sam.set_pair_info(r1, r2) - assert is_properly_paired(r1, r2) + assert is_proper_pair(r1, r2) -def test_is_properly_paired_when_actually_proper_and_no_r2() -> None: - """Test that is_properly_paired returns True when reads are properly paired, but no R2.""" +def test_is_proper_pair_when_actually_proper_and_no_r2() -> None: + """Test that is_proper_pair returns True when reads are properly paired, but no R2.""" builder = SamBuilder() r1, r2 = builder.add_pair(chrom="chr1", start1=100, cigar1="115M", start2=250, cigar2="40M") - assert is_properly_paired(r1) + assert is_proper_pair(r1) r1, r2 = builder.add_pair(chrom="chr1", start1=100, cigar1="10M", start2=100, cigar2="10M") r1.is_reverse = True r2.is_reverse = False sam.set_pair_info(r1, r2) - assert is_properly_paired(r1) + assert is_proper_pair(r1) -def test_not_is_properly_paired_if_wrong_orientation() -> None: +def test_not_is_proper_pair_if_wrong_orientation() -> None: """Test that reads are not properly paired if they are not in the right orientation.""" builder = SamBuilder() r1, r2 = builder.add_pair(chrom="chr1", start1=100, cigar1="115M", start2=250, cigar2="40M") r1.is_forward = False r2.is_forward = True sam.set_pair_info(r1, r2) - assert not is_properly_paired(r1, r2) + assert not is_proper_pair(r1, r2) r1, r2 = builder.add_pair(chrom="chr1", start1=100, cigar1="115M", start2=250, cigar2="40M") r1.is_forward = True r2.is_forward = True sam.set_pair_info(r1, r2) - assert not is_properly_paired(r1, r2) + assert not is_proper_pair(r1, r2) r1, r2 = builder.add_pair(chrom="chr1", start1=100, cigar1="115M", start2=250, cigar2="40M") r1.is_forward = False r2.is_forward = False sam.set_pair_info(r1, r2) - assert not is_properly_paired(r1, r2) + assert not is_proper_pair(r1, r2) -def test_not_is_properly_paired_if_wrong_orientation_and_no_r2() -> None: +def test_not_is_proper_pair_if_wrong_orientation_and_no_r2() -> None: """Test reads are not properly paired if they are not in the right orientation, but no R2.""" builder = SamBuilder() r1, r2 = builder.add_pair(chrom="chr1", start1=100, cigar1="115M", start2=250, cigar2="40M") r1.is_forward = False r2.is_forward = True sam.set_pair_info(r1, r2) - assert not is_properly_paired(r1) + assert not is_proper_pair(r1) r1, r2 = builder.add_pair(chrom="chr1", start1=100, cigar1="115M", start2=250, cigar2="40M") r1.is_forward = True r2.is_forward = True sam.set_pair_info(r1, r2) - assert not is_properly_paired(r1) + assert not is_proper_pair(r1) r1, r2 = builder.add_pair(chrom="chr1", start1=100, cigar1="115M", start2=250, cigar2="40M") r1.is_forward = False r2.is_forward = False sam.set_pair_info(r1, r2) - assert not is_properly_paired(r1) + assert not is_proper_pair(r1) -def test_not_is_properly_paired_if_too_far_apart() -> None: +def test_not_is_proper_pair_if_too_far_apart() -> None: """Test that reads are not properly paired if they are too far apart.""" builder = SamBuilder() r1, r2 = builder.add_pair(chrom="chr1", start1=100, start2=100 + 1000) sam.set_pair_info(r1, r2) - assert not is_properly_paired(r1, r2) + assert not is_proper_pair(r1, r2) def test_isize() -> None: From b880b65ac1ad52cfe9979853750705142227c042 Mon Sep 17 00:00:00 2001 From: clintval Date: Thu, 26 Dec 2024 20:32:10 -0500 Subject: [PATCH 07/36] Deprecate set_pair_info and _set_mate_info for set_mate_info --- fgpyo/sam/__init__.py | 101 ++++++-- fgpyo/sam/builder.py | 78 +----- poetry.lock | 447 ++++++++++++++++---------------- pyproject.toml | 2 +- tests/fgpyo/sam/test_builder.py | 53 ++-- tests/fgpyo/sam/test_sam.py | 50 ++-- 6 files changed, 379 insertions(+), 352 deletions(-) diff --git a/fgpyo/sam/__init__.py b/fgpyo/sam/__init__.py index f5c7404a..51e02cbd 100644 --- a/fgpyo/sam/__init__.py +++ b/fgpyo/sam/__init__.py @@ -162,6 +162,7 @@ from pathlib import Path from typing import IO from typing import Any +from typing import Callable from typing import Dict from typing import Iterable from typing import Iterator @@ -176,6 +177,7 @@ from pysam import AlignedSegment from pysam import AlignmentFile as SamFile from pysam import AlignmentHeader as SamHeader +from typing_extensions import deprecated import fgpyo.io from fgpyo.collections import PeekableIterator @@ -802,38 +804,101 @@ def isize(r1: AlignedSegment, r2: AlignedSegment) -> int: return r2_pos - r1_pos -def set_pair_info(r1: AlignedSegment, r2: AlignedSegment, proper_pair: bool = True) -> None: - """Resets mate pair information between reads in a pair. Requires that both r1 - and r2 are mapped. Can be handed reads that already have pairing flags setup or - independent R1 and R2 records that are currently flagged as SE reads. +def sum_of_base_qualities(rec: AlignedSegment, min_quality_score: int = 15) -> int: + """Calculate the sum of base qualities score for an alignment record. + This function is useful for calculating the "mate score" as implemented in samtools fixmate. + Args: + rec: The alignment record to calculate the sum of base qualities from. + min_quality_score: The minimum base quality score to use for summation. + See: + [`calc_sum_of_base_qualities()`](https://github.com/samtools/samtools/blob/4f3a7397a1f841020074c0048c503a01a52d5fa2/bam_mate.c#L227-L238) + [`MD_MIN_QUALITY`](https://github.com/samtools/samtools/blob/4f3a7397a1f841020074c0048c503a01a52d5fa2/bam_mate.c#L42) + """ + score: int = sum(qual for qual in rec.query_qualities if qual >= min_quality_score) + return score + + +def set_mate_info( + r1: AlignedSegment, + r2: AlignedSegment, + is_proper_pair: Callable[[AlignedSegment, AlignedSegment], bool] = is_proper_pair, +) -> None: + """Resets mate pair information between reads in a pair. + + Args: + r1: Read 1 (first read in the template). + r2: Read 2 with the same query name as r1 (second read in the template). + is_proper_pair: A function that takes the two alignments and determines proper pair status. + """ + if r1.query_name != r2.query_name: + raise ValueError("Cannot set mate info on alignments with different query names!") + + for src, dest in [(r1, r2), (r2, r1)]: + dest.next_reference_id = src.reference_id + dest.next_reference_name = src.reference_name + dest.next_reference_start = src.reference_start + dest.mate_is_forward = src.is_forward + dest.mate_is_mapped = src.is_mapped + dest.set_tag("MC", src.cigarstring) + dest.set_tag("MQ", src.mapping_quality) + + r1.set_tag("ms", sum_of_base_qualities(r2)) + r2.set_tag("ms", sum_of_base_qualities(r1)) + + template_length = isize(r1, r2) + r1.template_length = template_length + r2.template_length = -template_length + + proper_pair = is_proper_pair(r1, r2) + r1.is_proper_pair = proper_pair + r2.is_proper_pair = proper_pair + + +def set_as_pairs( + r1: AlignedSegment, + r2: AlignedSegment, + is_proper_pair: Callable[[AlignedSegment, AlignedSegment], bool] = is_proper_pair, +) -> None: + """Forces the two reads to become pairs as long as they share the same query name. + + This function will take two reads, as long as they have the same query name, and make them + pairs. The reads are marked as pairs and then first and second read flags are set. Finally, all + mate information is reset upon both reads. + + This function is useful for taking once-single-end reads and making them pairs. Args: - r1: read 1 - r2: read 2 with the same queryname as r1 + r1: Read 1 (first read in the template). + r2: Read 2 with the same query name as r1 (second read in the template). + is_proper_pair: A function that takes the two reads and determines proper pair status. """ if r1.query_name != r2.query_name: - raise ValueError("Cannot set pair info on reads with different query names!") + raise ValueError("Cannot pair reads with different query names!") for r in [r1, r2]: r.is_paired = True - r.is_proper_pair = proper_pair r1.is_read1 = True r1.is_read2 = False r2.is_read2 = True r2.is_read1 = False - for src, dest in [(r1, r2), (r2, r1)]: - dest.next_reference_id = src.reference_id - dest.next_reference_start = src.reference_start - dest.mate_is_reverse = src.is_reverse - dest.mate_is_unmapped = src.mate_is_unmapped - dest.set_tag("MC", src.cigarstring) - dest.set_tag("MQ", src.mapping_quality) + set_mate_info(r1=r1, r2=r2, is_proper_pair=is_proper_pair) - insert_size = isize(r1, r2) - r1.template_length = insert_size - r2.template_length = -insert_size + +@deprecated("Use `set_mate_info()` instead. Deprecated as of fgpyo 0.8.0.") +def set_pair_info(r1: AlignedSegment, r2: AlignedSegment, proper_pair: bool = True) -> None: + """Resets mate pair information between reads in a pair. + + Requires that both r1 and r2 are mapped. Can be handed reads that already have pairing flags + setup or independent R1 and R2 records that are currently flagged as SE reads. + + Args: + r1: Read 1 (first read in the template). + r2: Read 2 with the same query name as r1 (second read in the template). + proper_pair: whether the pair is proper or not. + """ + set_as_pairs(r1, r2, lambda r1, r2: proper_pair) @attr.s(frozen=True, auto_attribs=True) diff --git a/fgpyo/sam/builder.py b/fgpyo/sam/builder.py index 4a7b58d4..53997c25 100755 --- a/fgpyo/sam/builder.py +++ b/fgpyo/sam/builder.py @@ -264,70 +264,6 @@ def _set_length_dependent_fields( if not rec.is_unmapped: rec.cigarstring = cigar if cigar else f"{length}M" - def _set_mate_info(self, r1: pysam.AlignedSegment, r2: pysam.AlignedSegment) -> None: - """Sets the mate information on a pair of sam records. - - Handles cases where both reads are mapped, one of the two reads is unmapped or both reads - are unmapped. - - Args: - r1: the first read in the pair - r2: the sceond read in the pair - """ - for rec in r1, r2: - rec.template_length = 0 - rec.is_proper_pair = False - - if r1.is_unmapped and r2.is_unmapped: - # If they're both unmapped just clean the records up - for rec, other in [(r1, r2), (r2, r1)]: - rec.reference_id = sam.NO_REF_INDEX - rec.next_reference_id = sam.NO_REF_INDEX - rec.reference_start = sam.NO_REF_POS - rec.next_reference_start = sam.NO_REF_POS - rec.is_unmapped = True - rec.mate_is_unmapped = True - rec.is_proper_pair = False - rec.mate_is_reverse = other.is_reverse - - elif r1.is_unmapped or r2.is_unmapped: - # If only one is mapped/unmapped copy over the relevant stuff - (m, u) = (r1, r2) if r2.is_unmapped else (r2, r1) - u.reference_id = m.reference_id - u.reference_start = m.reference_start - u.next_reference_id = m.reference_id - u.next_reference_start = m.reference_start - u.mate_is_reverse = m.is_reverse - u.mate_is_unmapped = False - u.set_tag("MC", m.cigarstring) - - m.next_reference_id = u.reference_id - m.next_reference_start = u.reference_start - m.mate_is_reverse = u.is_reverse - m.mate_is_unmapped = True - - else: - # Else they are both mapped - for rec, other in [(r1, r2), (r2, r1)]: - rec.next_reference_id = other.reference_id - rec.next_reference_start = other.reference_start - rec.mate_is_reverse = other.is_reverse - rec.mate_is_unmapped = False - rec.set_tag("MC", other.cigarstring) - - if r1.reference_id == r2.reference_id: - r1p = r1.reference_end if r1.is_reverse else r1.reference_start - r2p = r2.reference_end if r2.is_reverse else r2.reference_start - r1.template_length = r2p - r1p - r2.template_length = r1p - r2p - - # Arbitrarily set proper pair if the we have an FR pair with isize <= 1000 - if r1.is_reverse != r2.is_reverse and abs(r1.template_length) <= 1000: - fpos, rpos = (r2p, r1p) if r1.is_reverse else (r1p, r2p) - if fpos < rpos: - r1.is_proper_pair = True - r2.is_proper_pair = True - def rg(self) -> Dict[str, Any]: """Returns the single read group that is defined in the header.""" # The `RG` field contains a list of read group mappings @@ -444,8 +380,16 @@ def add_pair( raise ValueError("Cannot use chrom in combination with chrom1 or chrom2") chrom = sam.NO_REF_NAME if chrom is None else chrom - chrom1 = next(c for c in (chrom1, chrom) if c is not None) - chrom2 = next(c for c in (chrom2, chrom) if c is not None) + + if start1 != sam.NO_REF_POS: + chrom1 = next(c for c in (chrom1, chrom) if c is not None) + else: + chrom1 = sam.NO_REF_NAME + + if start2 != sam.NO_REF_POS: + chrom2 = next(c for c in (chrom2, chrom) if c is not None) + else: + chrom2 = sam.NO_REF_NAME if chrom1 == sam.NO_REF_NAME and start1 != sam.NO_REF_POS: raise ValueError("start1 cannot be used on its own - specify chrom or chrom1") @@ -468,7 +412,7 @@ def add_pair( ) # Sync up mate info and we're done! - self._set_mate_info(r1, r2) + sam.set_mate_info(r1, r2) self._records.append(r1) self._records.append(r2) return r1, r2 diff --git a/poetry.lock b/poetry.lock index 926207d6..46b3478a 100644 --- a/poetry.lock +++ b/poetry.lock @@ -2,19 +2,19 @@ [[package]] name = "attrs" -version = "24.2.0" +version = "24.3.0" description = "Classes Without Boilerplate" optional = false -python-versions = ">=3.7" +python-versions = ">=3.8" files = [ - {file = "attrs-24.2.0-py3-none-any.whl", hash = "sha256:81921eb96de3191c8258c199618104dd27ac608d9366f5e35d011eae1867ede2"}, - {file = "attrs-24.2.0.tar.gz", hash = "sha256:5cfb1b9148b5b086569baec03f20d7b6bf3bcacc9a42bebf87ffaaca362f6346"}, + {file = "attrs-24.3.0-py3-none-any.whl", hash = "sha256:ac96cd038792094f438ad1f6ff80837353805ac950cd2aa0e0625ef19850c308"}, + {file = "attrs-24.3.0.tar.gz", hash = "sha256:8f5c07333d543103541ba7be0e2ce16eeee8130cb0b3f9238ab904ce1e85baff"}, ] [package.extras] benchmark = ["cloudpickle", "hypothesis", "mypy (>=1.11.1)", "pympler", "pytest (>=4.3.0)", "pytest-codspeed", "pytest-mypy-plugins", "pytest-xdist[psutil]"] cov = ["cloudpickle", "coverage[toml] (>=5.3)", "hypothesis", "mypy (>=1.11.1)", "pympler", "pytest (>=4.3.0)", "pytest-mypy-plugins", "pytest-xdist[psutil]"] -dev = ["cloudpickle", "hypothesis", "mypy (>=1.11.1)", "pre-commit", "pympler", "pytest (>=4.3.0)", "pytest-mypy-plugins", "pytest-xdist[psutil]"] +dev = ["cloudpickle", "hypothesis", "mypy (>=1.11.1)", "pre-commit-uv", "pympler", "pytest (>=4.3.0)", "pytest-mypy-plugins", "pytest-xdist[psutil]"] docs = ["cogapp", "furo", "myst-parser", "sphinx", "sphinx-notfound-page", "sphinxcontrib-towncrier", "towncrier (<24.7)"] tests = ["cloudpickle", "hypothesis", "mypy (>=1.11.1)", "pympler", "pytest (>=4.3.0)", "pytest-mypy-plugins", "pytest-xdist[psutil]"] tests-mypy = ["mypy (>=1.11.1)", "pytest-mypy-plugins"] @@ -46,138 +46,125 @@ files = [ [[package]] name = "certifi" -version = "2024.8.30" +version = "2024.12.14" description = "Python package for providing Mozilla's CA Bundle." optional = false python-versions = ">=3.6" files = [ - {file = "certifi-2024.8.30-py3-none-any.whl", hash = "sha256:922820b53db7a7257ffbda3f597266d435245903d80737e34f8a45ff3e3230d8"}, - {file = "certifi-2024.8.30.tar.gz", hash = "sha256:bec941d2aa8195e248a60b31ff9f0558284cf01a52591ceda73ea9afffd69fd9"}, + {file = "certifi-2024.12.14-py3-none-any.whl", hash = "sha256:1275f7a45be9464efc1173084eaa30f866fe2e47d389406136d332ed4967ec56"}, + {file = "certifi-2024.12.14.tar.gz", hash = "sha256:b650d30f370c2b724812bee08008be0c4163b163ddaec3f2546c1caf65f191db"}, ] [[package]] name = "charset-normalizer" -version = "3.4.0" +version = "3.4.1" description = "The Real First Universal Charset Detector. Open, modern and actively maintained alternative to Chardet." optional = false -python-versions = ">=3.7.0" +python-versions = ">=3.7" files = [ - {file = "charset_normalizer-3.4.0-cp310-cp310-macosx_10_9_universal2.whl", hash = "sha256:4f9fc98dad6c2eaa32fc3af1417d95b5e3d08aff968df0cd320066def971f9a6"}, - {file = "charset_normalizer-3.4.0-cp310-cp310-macosx_10_9_x86_64.whl", hash = "sha256:0de7b687289d3c1b3e8660d0741874abe7888100efe14bd0f9fd7141bcbda92b"}, - {file = "charset_normalizer-3.4.0-cp310-cp310-macosx_11_0_arm64.whl", hash = "sha256:5ed2e36c3e9b4f21dd9422f6893dec0abf2cca553af509b10cd630f878d3eb99"}, - {file = "charset_normalizer-3.4.0-cp310-cp310-manylinux_2_17_aarch64.manylinux2014_aarch64.whl", hash = "sha256:40d3ff7fc90b98c637bda91c89d51264a3dcf210cade3a2c6f838c7268d7a4ca"}, - {file = "charset_normalizer-3.4.0-cp310-cp310-manylinux_2_17_ppc64le.manylinux2014_ppc64le.whl", hash = "sha256:1110e22af8ca26b90bd6364fe4c763329b0ebf1ee213ba32b68c73de5752323d"}, - {file = "charset_normalizer-3.4.0-cp310-cp310-manylinux_2_17_s390x.manylinux2014_s390x.whl", hash = "sha256:86f4e8cca779080f66ff4f191a685ced73d2f72d50216f7112185dc02b90b9b7"}, - {file = "charset_normalizer-3.4.0-cp310-cp310-manylinux_2_17_x86_64.manylinux2014_x86_64.whl", hash = "sha256:7f683ddc7eedd742e2889d2bfb96d69573fde1d92fcb811979cdb7165bb9c7d3"}, - {file = "charset_normalizer-3.4.0-cp310-cp310-manylinux_2_5_i686.manylinux1_i686.manylinux_2_17_i686.manylinux2014_i686.whl", hash = "sha256:27623ba66c183eca01bf9ff833875b459cad267aeeb044477fedac35e19ba907"}, - {file = "charset_normalizer-3.4.0-cp310-cp310-musllinux_1_2_aarch64.whl", hash = "sha256:f606a1881d2663630ea5b8ce2efe2111740df4b687bd78b34a8131baa007f79b"}, - {file = "charset_normalizer-3.4.0-cp310-cp310-musllinux_1_2_i686.whl", hash = "sha256:0b309d1747110feb25d7ed6b01afdec269c647d382c857ef4663bbe6ad95a912"}, - {file = "charset_normalizer-3.4.0-cp310-cp310-musllinux_1_2_ppc64le.whl", hash = "sha256:136815f06a3ae311fae551c3df1f998a1ebd01ddd424aa5603a4336997629e95"}, - {file = "charset_normalizer-3.4.0-cp310-cp310-musllinux_1_2_s390x.whl", hash = "sha256:14215b71a762336254351b00ec720a8e85cada43b987da5a042e4ce3e82bd68e"}, - {file = "charset_normalizer-3.4.0-cp310-cp310-musllinux_1_2_x86_64.whl", hash = "sha256:79983512b108e4a164b9c8d34de3992f76d48cadc9554c9e60b43f308988aabe"}, - {file = "charset_normalizer-3.4.0-cp310-cp310-win32.whl", hash = "sha256:c94057af19bc953643a33581844649a7fdab902624d2eb739738a30e2b3e60fc"}, - {file = "charset_normalizer-3.4.0-cp310-cp310-win_amd64.whl", hash = "sha256:55f56e2ebd4e3bc50442fbc0888c9d8c94e4e06a933804e2af3e89e2f9c1c749"}, - {file = "charset_normalizer-3.4.0-cp311-cp311-macosx_10_9_universal2.whl", hash = "sha256:0d99dd8ff461990f12d6e42c7347fd9ab2532fb70e9621ba520f9e8637161d7c"}, - {file = "charset_normalizer-3.4.0-cp311-cp311-macosx_10_9_x86_64.whl", hash = "sha256:c57516e58fd17d03ebe67e181a4e4e2ccab1168f8c2976c6a334d4f819fe5944"}, - {file = "charset_normalizer-3.4.0-cp311-cp311-macosx_11_0_arm64.whl", hash = "sha256:6dba5d19c4dfab08e58d5b36304b3f92f3bd5d42c1a3fa37b5ba5cdf6dfcbcee"}, - {file = "charset_normalizer-3.4.0-cp311-cp311-manylinux_2_17_aarch64.manylinux2014_aarch64.whl", hash = "sha256:bf4475b82be41b07cc5e5ff94810e6a01f276e37c2d55571e3fe175e467a1a1c"}, - {file = "charset_normalizer-3.4.0-cp311-cp311-manylinux_2_17_ppc64le.manylinux2014_ppc64le.whl", hash = "sha256:ce031db0408e487fd2775d745ce30a7cd2923667cf3b69d48d219f1d8f5ddeb6"}, - {file = "charset_normalizer-3.4.0-cp311-cp311-manylinux_2_17_s390x.manylinux2014_s390x.whl", hash = "sha256:8ff4e7cdfdb1ab5698e675ca622e72d58a6fa2a8aa58195de0c0061288e6e3ea"}, - {file = "charset_normalizer-3.4.0-cp311-cp311-manylinux_2_17_x86_64.manylinux2014_x86_64.whl", hash = "sha256:3710a9751938947e6327ea9f3ea6332a09bf0ba0c09cae9cb1f250bd1f1549bc"}, - {file = "charset_normalizer-3.4.0-cp311-cp311-manylinux_2_5_i686.manylinux1_i686.manylinux_2_17_i686.manylinux2014_i686.whl", hash = "sha256:82357d85de703176b5587dbe6ade8ff67f9f69a41c0733cf2425378b49954de5"}, - {file = "charset_normalizer-3.4.0-cp311-cp311-musllinux_1_2_aarch64.whl", hash = "sha256:47334db71978b23ebcf3c0f9f5ee98b8d65992b65c9c4f2d34c2eaf5bcaf0594"}, - {file = "charset_normalizer-3.4.0-cp311-cp311-musllinux_1_2_i686.whl", hash = "sha256:8ce7fd6767a1cc5a92a639b391891bf1c268b03ec7e021c7d6d902285259685c"}, - {file = "charset_normalizer-3.4.0-cp311-cp311-musllinux_1_2_ppc64le.whl", hash = "sha256:f1a2f519ae173b5b6a2c9d5fa3116ce16e48b3462c8b96dfdded11055e3d6365"}, - {file = "charset_normalizer-3.4.0-cp311-cp311-musllinux_1_2_s390x.whl", hash = "sha256:63bc5c4ae26e4bc6be6469943b8253c0fd4e4186c43ad46e713ea61a0ba49129"}, - {file = "charset_normalizer-3.4.0-cp311-cp311-musllinux_1_2_x86_64.whl", hash = "sha256:bcb4f8ea87d03bc51ad04add8ceaf9b0f085ac045ab4d74e73bbc2dc033f0236"}, - {file = "charset_normalizer-3.4.0-cp311-cp311-win32.whl", hash = "sha256:9ae4ef0b3f6b41bad6366fb0ea4fc1d7ed051528e113a60fa2a65a9abb5b1d99"}, - {file = "charset_normalizer-3.4.0-cp311-cp311-win_amd64.whl", hash = "sha256:cee4373f4d3ad28f1ab6290684d8e2ebdb9e7a1b74fdc39e4c211995f77bec27"}, - {file = "charset_normalizer-3.4.0-cp312-cp312-macosx_10_13_universal2.whl", hash = "sha256:0713f3adb9d03d49d365b70b84775d0a0d18e4ab08d12bc46baa6132ba78aaf6"}, - {file = "charset_normalizer-3.4.0-cp312-cp312-macosx_10_13_x86_64.whl", hash = "sha256:de7376c29d95d6719048c194a9cf1a1b0393fbe8488a22008610b0361d834ecf"}, - {file = "charset_normalizer-3.4.0-cp312-cp312-macosx_11_0_arm64.whl", hash = "sha256:4a51b48f42d9358460b78725283f04bddaf44a9358197b889657deba38f329db"}, - {file = "charset_normalizer-3.4.0-cp312-cp312-manylinux_2_17_aarch64.manylinux2014_aarch64.whl", hash = "sha256:b295729485b06c1a0683af02a9e42d2caa9db04a373dc38a6a58cdd1e8abddf1"}, - {file = "charset_normalizer-3.4.0-cp312-cp312-manylinux_2_17_ppc64le.manylinux2014_ppc64le.whl", hash = "sha256:ee803480535c44e7f5ad00788526da7d85525cfefaf8acf8ab9a310000be4b03"}, - {file = "charset_normalizer-3.4.0-cp312-cp312-manylinux_2_17_s390x.manylinux2014_s390x.whl", hash = "sha256:3d59d125ffbd6d552765510e3f31ed75ebac2c7470c7274195b9161a32350284"}, - {file = "charset_normalizer-3.4.0-cp312-cp312-manylinux_2_17_x86_64.manylinux2014_x86_64.whl", hash = "sha256:8cda06946eac330cbe6598f77bb54e690b4ca93f593dee1568ad22b04f347c15"}, - {file = "charset_normalizer-3.4.0-cp312-cp312-manylinux_2_5_i686.manylinux1_i686.manylinux_2_17_i686.manylinux2014_i686.whl", hash = "sha256:07afec21bbbbf8a5cc3651aa96b980afe2526e7f048fdfb7f1014d84acc8b6d8"}, - {file = "charset_normalizer-3.4.0-cp312-cp312-musllinux_1_2_aarch64.whl", hash = "sha256:6b40e8d38afe634559e398cc32b1472f376a4099c75fe6299ae607e404c033b2"}, - {file = "charset_normalizer-3.4.0-cp312-cp312-musllinux_1_2_i686.whl", hash = "sha256:b8dcd239c743aa2f9c22ce674a145e0a25cb1566c495928440a181ca1ccf6719"}, - {file = "charset_normalizer-3.4.0-cp312-cp312-musllinux_1_2_ppc64le.whl", hash = "sha256:84450ba661fb96e9fd67629b93d2941c871ca86fc38d835d19d4225ff946a631"}, - {file = "charset_normalizer-3.4.0-cp312-cp312-musllinux_1_2_s390x.whl", hash = "sha256:44aeb140295a2f0659e113b31cfe92c9061622cadbc9e2a2f7b8ef6b1e29ef4b"}, - {file = "charset_normalizer-3.4.0-cp312-cp312-musllinux_1_2_x86_64.whl", hash = "sha256:1db4e7fefefd0f548d73e2e2e041f9df5c59e178b4c72fbac4cc6f535cfb1565"}, - {file = "charset_normalizer-3.4.0-cp312-cp312-win32.whl", hash = "sha256:5726cf76c982532c1863fb64d8c6dd0e4c90b6ece9feb06c9f202417a31f7dd7"}, - {file = "charset_normalizer-3.4.0-cp312-cp312-win_amd64.whl", hash = "sha256:b197e7094f232959f8f20541ead1d9862ac5ebea1d58e9849c1bf979255dfac9"}, - {file = "charset_normalizer-3.4.0-cp313-cp313-macosx_10_13_universal2.whl", hash = "sha256:dd4eda173a9fcccb5f2e2bd2a9f423d180194b1bf17cf59e3269899235b2a114"}, - {file = "charset_normalizer-3.4.0-cp313-cp313-macosx_10_13_x86_64.whl", hash = "sha256:e9e3c4c9e1ed40ea53acf11e2a386383c3304212c965773704e4603d589343ed"}, - {file = "charset_normalizer-3.4.0-cp313-cp313-macosx_11_0_arm64.whl", hash = "sha256:92a7e36b000bf022ef3dbb9c46bfe2d52c047d5e3f3343f43204263c5addc250"}, - {file = "charset_normalizer-3.4.0-cp313-cp313-manylinux_2_17_aarch64.manylinux2014_aarch64.whl", hash = "sha256:54b6a92d009cbe2fb11054ba694bc9e284dad30a26757b1e372a1fdddaf21920"}, - {file = "charset_normalizer-3.4.0-cp313-cp313-manylinux_2_17_ppc64le.manylinux2014_ppc64le.whl", hash = "sha256:1ffd9493de4c922f2a38c2bf62b831dcec90ac673ed1ca182fe11b4d8e9f2a64"}, - {file = "charset_normalizer-3.4.0-cp313-cp313-manylinux_2_17_s390x.manylinux2014_s390x.whl", hash = "sha256:35c404d74c2926d0287fbd63ed5d27eb911eb9e4a3bb2c6d294f3cfd4a9e0c23"}, - {file = "charset_normalizer-3.4.0-cp313-cp313-manylinux_2_17_x86_64.manylinux2014_x86_64.whl", hash = "sha256:4796efc4faf6b53a18e3d46343535caed491776a22af773f366534056c4e1fbc"}, - {file = "charset_normalizer-3.4.0-cp313-cp313-manylinux_2_5_i686.manylinux1_i686.manylinux_2_17_i686.manylinux2014_i686.whl", hash = "sha256:e7fdd52961feb4c96507aa649550ec2a0d527c086d284749b2f582f2d40a2e0d"}, - {file = "charset_normalizer-3.4.0-cp313-cp313-musllinux_1_2_aarch64.whl", hash = "sha256:92db3c28b5b2a273346bebb24857fda45601aef6ae1c011c0a997106581e8a88"}, - {file = "charset_normalizer-3.4.0-cp313-cp313-musllinux_1_2_i686.whl", hash = "sha256:ab973df98fc99ab39080bfb0eb3a925181454d7c3ac8a1e695fddfae696d9e90"}, - {file = "charset_normalizer-3.4.0-cp313-cp313-musllinux_1_2_ppc64le.whl", hash = "sha256:4b67fdab07fdd3c10bb21edab3cbfe8cf5696f453afce75d815d9d7223fbe88b"}, - {file = "charset_normalizer-3.4.0-cp313-cp313-musllinux_1_2_s390x.whl", hash = "sha256:aa41e526a5d4a9dfcfbab0716c7e8a1b215abd3f3df5a45cf18a12721d31cb5d"}, - {file = "charset_normalizer-3.4.0-cp313-cp313-musllinux_1_2_x86_64.whl", hash = "sha256:ffc519621dce0c767e96b9c53f09c5d215578e10b02c285809f76509a3931482"}, - {file = "charset_normalizer-3.4.0-cp313-cp313-win32.whl", hash = "sha256:f19c1585933c82098c2a520f8ec1227f20e339e33aca8fa6f956f6691b784e67"}, - {file = "charset_normalizer-3.4.0-cp313-cp313-win_amd64.whl", hash = "sha256:707b82d19e65c9bd28b81dde95249b07bf9f5b90ebe1ef17d9b57473f8a64b7b"}, - {file = "charset_normalizer-3.4.0-cp37-cp37m-macosx_10_9_x86_64.whl", hash = "sha256:dbe03226baf438ac4fda9e2d0715022fd579cb641c4cf639fa40d53b2fe6f3e2"}, - {file = "charset_normalizer-3.4.0-cp37-cp37m-manylinux_2_17_aarch64.manylinux2014_aarch64.whl", hash = "sha256:dd9a8bd8900e65504a305bf8ae6fa9fbc66de94178c420791d0293702fce2df7"}, - {file = "charset_normalizer-3.4.0-cp37-cp37m-manylinux_2_17_ppc64le.manylinux2014_ppc64le.whl", hash = "sha256:b8831399554b92b72af5932cdbbd4ddc55c55f631bb13ff8fe4e6536a06c5c51"}, - {file = "charset_normalizer-3.4.0-cp37-cp37m-manylinux_2_17_s390x.manylinux2014_s390x.whl", hash = "sha256:a14969b8691f7998e74663b77b4c36c0337cb1df552da83d5c9004a93afdb574"}, - {file = "charset_normalizer-3.4.0-cp37-cp37m-manylinux_2_17_x86_64.manylinux2014_x86_64.whl", hash = "sha256:dcaf7c1524c0542ee2fc82cc8ec337f7a9f7edee2532421ab200d2b920fc97cf"}, - {file = "charset_normalizer-3.4.0-cp37-cp37m-manylinux_2_5_i686.manylinux1_i686.manylinux_2_17_i686.manylinux2014_i686.whl", hash = "sha256:425c5f215d0eecee9a56cdb703203dda90423247421bf0d67125add85d0c4455"}, - {file = "charset_normalizer-3.4.0-cp37-cp37m-musllinux_1_2_aarch64.whl", hash = "sha256:d5b054862739d276e09928de37c79ddeec42a6e1bfc55863be96a36ba22926f6"}, - {file = "charset_normalizer-3.4.0-cp37-cp37m-musllinux_1_2_i686.whl", hash = "sha256:f3e73a4255342d4eb26ef6df01e3962e73aa29baa3124a8e824c5d3364a65748"}, - {file = "charset_normalizer-3.4.0-cp37-cp37m-musllinux_1_2_ppc64le.whl", hash = "sha256:2f6c34da58ea9c1a9515621f4d9ac379871a8f21168ba1b5e09d74250de5ad62"}, - {file = "charset_normalizer-3.4.0-cp37-cp37m-musllinux_1_2_s390x.whl", hash = "sha256:f09cb5a7bbe1ecae6e87901a2eb23e0256bb524a79ccc53eb0b7629fbe7677c4"}, - {file = "charset_normalizer-3.4.0-cp37-cp37m-musllinux_1_2_x86_64.whl", hash = "sha256:0099d79bdfcf5c1f0c2c72f91516702ebf8b0b8ddd8905f97a8aecf49712c621"}, - {file = "charset_normalizer-3.4.0-cp37-cp37m-win32.whl", hash = "sha256:9c98230f5042f4945f957d006edccc2af1e03ed5e37ce7c373f00a5a4daa6149"}, - {file = "charset_normalizer-3.4.0-cp37-cp37m-win_amd64.whl", hash = "sha256:62f60aebecfc7f4b82e3f639a7d1433a20ec32824db2199a11ad4f5e146ef5ee"}, - {file = "charset_normalizer-3.4.0-cp38-cp38-macosx_10_9_universal2.whl", hash = "sha256:af73657b7a68211996527dbfeffbb0864e043d270580c5aef06dc4b659a4b578"}, - {file = "charset_normalizer-3.4.0-cp38-cp38-macosx_10_9_x86_64.whl", hash = "sha256:cab5d0b79d987c67f3b9e9c53f54a61360422a5a0bc075f43cab5621d530c3b6"}, - {file = "charset_normalizer-3.4.0-cp38-cp38-macosx_11_0_arm64.whl", hash = "sha256:9289fd5dddcf57bab41d044f1756550f9e7cf0c8e373b8cdf0ce8773dc4bd417"}, - {file = "charset_normalizer-3.4.0-cp38-cp38-manylinux_2_17_aarch64.manylinux2014_aarch64.whl", hash = "sha256:6b493a043635eb376e50eedf7818f2f322eabbaa974e948bd8bdd29eb7ef2a51"}, - {file = "charset_normalizer-3.4.0-cp38-cp38-manylinux_2_17_ppc64le.manylinux2014_ppc64le.whl", hash = "sha256:9fa2566ca27d67c86569e8c85297aaf413ffab85a8960500f12ea34ff98e4c41"}, - {file = "charset_normalizer-3.4.0-cp38-cp38-manylinux_2_17_s390x.manylinux2014_s390x.whl", hash = "sha256:a8e538f46104c815be19c975572d74afb53f29650ea2025bbfaef359d2de2f7f"}, - {file = "charset_normalizer-3.4.0-cp38-cp38-manylinux_2_17_x86_64.manylinux2014_x86_64.whl", hash = "sha256:6fd30dc99682dc2c603c2b315bded2799019cea829f8bf57dc6b61efde6611c8"}, - {file = "charset_normalizer-3.4.0-cp38-cp38-manylinux_2_5_i686.manylinux1_i686.manylinux_2_17_i686.manylinux2014_i686.whl", hash = "sha256:2006769bd1640bdf4d5641c69a3d63b71b81445473cac5ded39740a226fa88ab"}, - {file = "charset_normalizer-3.4.0-cp38-cp38-musllinux_1_2_aarch64.whl", hash = "sha256:dc15e99b2d8a656f8e666854404f1ba54765871104e50c8e9813af8a7db07f12"}, - {file = "charset_normalizer-3.4.0-cp38-cp38-musllinux_1_2_i686.whl", hash = "sha256:ab2e5bef076f5a235c3774b4f4028a680432cded7cad37bba0fd90d64b187d19"}, - {file = "charset_normalizer-3.4.0-cp38-cp38-musllinux_1_2_ppc64le.whl", hash = "sha256:4ec9dd88a5b71abfc74e9df5ebe7921c35cbb3b641181a531ca65cdb5e8e4dea"}, - {file = "charset_normalizer-3.4.0-cp38-cp38-musllinux_1_2_s390x.whl", hash = "sha256:43193c5cda5d612f247172016c4bb71251c784d7a4d9314677186a838ad34858"}, - {file = "charset_normalizer-3.4.0-cp38-cp38-musllinux_1_2_x86_64.whl", hash = "sha256:aa693779a8b50cd97570e5a0f343538a8dbd3e496fa5dcb87e29406ad0299654"}, - {file = "charset_normalizer-3.4.0-cp38-cp38-win32.whl", hash = "sha256:7706f5850360ac01d80c89bcef1640683cc12ed87f42579dab6c5d3ed6888613"}, - {file = "charset_normalizer-3.4.0-cp38-cp38-win_amd64.whl", hash = "sha256:c3e446d253bd88f6377260d07c895816ebf33ffffd56c1c792b13bff9c3e1ade"}, - {file = "charset_normalizer-3.4.0-cp39-cp39-macosx_10_9_universal2.whl", hash = "sha256:980b4f289d1d90ca5efcf07958d3eb38ed9c0b7676bf2831a54d4f66f9c27dfa"}, - {file = "charset_normalizer-3.4.0-cp39-cp39-macosx_10_9_x86_64.whl", hash = "sha256:f28f891ccd15c514a0981f3b9db9aa23d62fe1a99997512b0491d2ed323d229a"}, - {file = "charset_normalizer-3.4.0-cp39-cp39-macosx_11_0_arm64.whl", hash = "sha256:a8aacce6e2e1edcb6ac625fb0f8c3a9570ccc7bfba1f63419b3769ccf6a00ed0"}, - {file = "charset_normalizer-3.4.0-cp39-cp39-manylinux_2_17_aarch64.manylinux2014_aarch64.whl", hash = "sha256:bd7af3717683bea4c87acd8c0d3d5b44d56120b26fd3f8a692bdd2d5260c620a"}, - {file = "charset_normalizer-3.4.0-cp39-cp39-manylinux_2_17_ppc64le.manylinux2014_ppc64le.whl", hash = "sha256:5ff2ed8194587faf56555927b3aa10e6fb69d931e33953943bc4f837dfee2242"}, - {file = "charset_normalizer-3.4.0-cp39-cp39-manylinux_2_17_s390x.manylinux2014_s390x.whl", hash = "sha256:e91f541a85298cf35433bf66f3fab2a4a2cff05c127eeca4af174f6d497f0d4b"}, - {file = "charset_normalizer-3.4.0-cp39-cp39-manylinux_2_17_x86_64.manylinux2014_x86_64.whl", hash = "sha256:309a7de0a0ff3040acaebb35ec45d18db4b28232f21998851cfa709eeff49d62"}, - {file = "charset_normalizer-3.4.0-cp39-cp39-manylinux_2_5_i686.manylinux1_i686.manylinux_2_17_i686.manylinux2014_i686.whl", hash = "sha256:285e96d9d53422efc0d7a17c60e59f37fbf3dfa942073f666db4ac71e8d726d0"}, - {file = "charset_normalizer-3.4.0-cp39-cp39-musllinux_1_2_aarch64.whl", hash = "sha256:5d447056e2ca60382d460a604b6302d8db69476fd2015c81e7c35417cfabe4cd"}, - {file = "charset_normalizer-3.4.0-cp39-cp39-musllinux_1_2_i686.whl", hash = "sha256:20587d20f557fe189b7947d8e7ec5afa110ccf72a3128d61a2a387c3313f46be"}, - {file = "charset_normalizer-3.4.0-cp39-cp39-musllinux_1_2_ppc64le.whl", hash = "sha256:130272c698667a982a5d0e626851ceff662565379baf0ff2cc58067b81d4f11d"}, - {file = "charset_normalizer-3.4.0-cp39-cp39-musllinux_1_2_s390x.whl", hash = "sha256:ab22fbd9765e6954bc0bcff24c25ff71dcbfdb185fcdaca49e81bac68fe724d3"}, - {file = "charset_normalizer-3.4.0-cp39-cp39-musllinux_1_2_x86_64.whl", hash = "sha256:7782afc9b6b42200f7362858f9e73b1f8316afb276d316336c0ec3bd73312742"}, - {file = "charset_normalizer-3.4.0-cp39-cp39-win32.whl", hash = "sha256:2de62e8801ddfff069cd5c504ce3bc9672b23266597d4e4f50eda28846c322f2"}, - {file = "charset_normalizer-3.4.0-cp39-cp39-win_amd64.whl", hash = "sha256:95c3c157765b031331dd4db3c775e58deaee050a3042fcad72cbc4189d7c8dca"}, - {file = "charset_normalizer-3.4.0-py3-none-any.whl", hash = "sha256:fe9f97feb71aa9896b81973a7bbada8c49501dc73e58a10fcef6663af95e5079"}, - {file = "charset_normalizer-3.4.0.tar.gz", hash = "sha256:223217c3d4f82c3ac5e29032b3f1c2eb0fb591b72161f86d93f5719079dae93e"}, + {file = "charset_normalizer-3.4.1-cp310-cp310-macosx_10_9_universal2.whl", hash = "sha256:91b36a978b5ae0ee86c394f5a54d6ef44db1de0815eb43de826d41d21e4af3de"}, + {file = "charset_normalizer-3.4.1-cp310-cp310-manylinux_2_17_aarch64.manylinux2014_aarch64.whl", hash = "sha256:7461baadb4dc00fd9e0acbe254e3d7d2112e7f92ced2adc96e54ef6501c5f176"}, + {file = "charset_normalizer-3.4.1-cp310-cp310-manylinux_2_17_ppc64le.manylinux2014_ppc64le.whl", hash = "sha256:e218488cd232553829be0664c2292d3af2eeeb94b32bea483cf79ac6a694e037"}, + {file = "charset_normalizer-3.4.1-cp310-cp310-manylinux_2_17_s390x.manylinux2014_s390x.whl", hash = "sha256:80ed5e856eb7f30115aaf94e4a08114ccc8813e6ed1b5efa74f9f82e8509858f"}, + {file = "charset_normalizer-3.4.1-cp310-cp310-manylinux_2_17_x86_64.manylinux2014_x86_64.whl", hash = "sha256:b010a7a4fd316c3c484d482922d13044979e78d1861f0e0650423144c616a46a"}, + {file = "charset_normalizer-3.4.1-cp310-cp310-manylinux_2_5_i686.manylinux1_i686.manylinux_2_17_i686.manylinux2014_i686.whl", hash = "sha256:4532bff1b8421fd0a320463030c7520f56a79c9024a4e88f01c537316019005a"}, + {file = "charset_normalizer-3.4.1-cp310-cp310-musllinux_1_2_aarch64.whl", hash = "sha256:d973f03c0cb71c5ed99037b870f2be986c3c05e63622c017ea9816881d2dd247"}, + {file = "charset_normalizer-3.4.1-cp310-cp310-musllinux_1_2_i686.whl", hash = "sha256:3a3bd0dcd373514dcec91c411ddb9632c0d7d92aed7093b8c3bbb6d69ca74408"}, + {file = "charset_normalizer-3.4.1-cp310-cp310-musllinux_1_2_ppc64le.whl", hash = "sha256:d9c3cdf5390dcd29aa8056d13e8e99526cda0305acc038b96b30352aff5ff2bb"}, + {file = "charset_normalizer-3.4.1-cp310-cp310-musllinux_1_2_s390x.whl", hash = "sha256:2bdfe3ac2e1bbe5b59a1a63721eb3b95fc9b6817ae4a46debbb4e11f6232428d"}, + {file = "charset_normalizer-3.4.1-cp310-cp310-musllinux_1_2_x86_64.whl", hash = "sha256:eab677309cdb30d047996b36d34caeda1dc91149e4fdca0b1a039b3f79d9a807"}, + {file = "charset_normalizer-3.4.1-cp310-cp310-win32.whl", hash = "sha256:c0429126cf75e16c4f0ad00ee0eae4242dc652290f940152ca8c75c3a4b6ee8f"}, + {file = "charset_normalizer-3.4.1-cp310-cp310-win_amd64.whl", hash = "sha256:9f0b8b1c6d84c8034a44893aba5e767bf9c7a211e313a9605d9c617d7083829f"}, + {file = "charset_normalizer-3.4.1-cp311-cp311-macosx_10_9_universal2.whl", hash = "sha256:8bfa33f4f2672964266e940dd22a195989ba31669bd84629f05fab3ef4e2d125"}, + {file = "charset_normalizer-3.4.1-cp311-cp311-manylinux_2_17_aarch64.manylinux2014_aarch64.whl", hash = "sha256:28bf57629c75e810b6ae989f03c0828d64d6b26a5e205535585f96093e405ed1"}, + {file = "charset_normalizer-3.4.1-cp311-cp311-manylinux_2_17_ppc64le.manylinux2014_ppc64le.whl", hash = "sha256:f08ff5e948271dc7e18a35641d2f11a4cd8dfd5634f55228b691e62b37125eb3"}, + {file = "charset_normalizer-3.4.1-cp311-cp311-manylinux_2_17_s390x.manylinux2014_s390x.whl", hash = "sha256:234ac59ea147c59ee4da87a0c0f098e9c8d169f4dc2a159ef720f1a61bbe27cd"}, + {file = "charset_normalizer-3.4.1-cp311-cp311-manylinux_2_17_x86_64.manylinux2014_x86_64.whl", hash = "sha256:fd4ec41f914fa74ad1b8304bbc634b3de73d2a0889bd32076342a573e0779e00"}, + {file = "charset_normalizer-3.4.1-cp311-cp311-manylinux_2_5_i686.manylinux1_i686.manylinux_2_17_i686.manylinux2014_i686.whl", hash = "sha256:eea6ee1db730b3483adf394ea72f808b6e18cf3cb6454b4d86e04fa8c4327a12"}, + {file = "charset_normalizer-3.4.1-cp311-cp311-musllinux_1_2_aarch64.whl", hash = "sha256:c96836c97b1238e9c9e3fe90844c947d5afbf4f4c92762679acfe19927d81d77"}, + {file = "charset_normalizer-3.4.1-cp311-cp311-musllinux_1_2_i686.whl", hash = "sha256:4d86f7aff21ee58f26dcf5ae81a9addbd914115cdebcbb2217e4f0ed8982e146"}, + {file = "charset_normalizer-3.4.1-cp311-cp311-musllinux_1_2_ppc64le.whl", hash = "sha256:09b5e6733cbd160dcc09589227187e242a30a49ca5cefa5a7edd3f9d19ed53fd"}, + {file = "charset_normalizer-3.4.1-cp311-cp311-musllinux_1_2_s390x.whl", hash = "sha256:5777ee0881f9499ed0f71cc82cf873d9a0ca8af166dfa0af8ec4e675b7df48e6"}, + {file = "charset_normalizer-3.4.1-cp311-cp311-musllinux_1_2_x86_64.whl", hash = "sha256:237bdbe6159cff53b4f24f397d43c6336c6b0b42affbe857970cefbb620911c8"}, + {file = "charset_normalizer-3.4.1-cp311-cp311-win32.whl", hash = "sha256:8417cb1f36cc0bc7eaba8ccb0e04d55f0ee52df06df3ad55259b9a323555fc8b"}, + {file = "charset_normalizer-3.4.1-cp311-cp311-win_amd64.whl", hash = "sha256:d7f50a1f8c450f3925cb367d011448c39239bb3eb4117c36a6d354794de4ce76"}, + {file = "charset_normalizer-3.4.1-cp312-cp312-macosx_10_13_universal2.whl", hash = "sha256:73d94b58ec7fecbc7366247d3b0b10a21681004153238750bb67bd9012414545"}, + {file = "charset_normalizer-3.4.1-cp312-cp312-manylinux_2_17_aarch64.manylinux2014_aarch64.whl", hash = "sha256:dad3e487649f498dd991eeb901125411559b22e8d7ab25d3aeb1af367df5efd7"}, + {file = "charset_normalizer-3.4.1-cp312-cp312-manylinux_2_17_ppc64le.manylinux2014_ppc64le.whl", hash = "sha256:c30197aa96e8eed02200a83fba2657b4c3acd0f0aa4bdc9f6c1af8e8962e0757"}, + {file = "charset_normalizer-3.4.1-cp312-cp312-manylinux_2_17_s390x.manylinux2014_s390x.whl", hash = "sha256:2369eea1ee4a7610a860d88f268eb39b95cb588acd7235e02fd5a5601773d4fa"}, + {file = "charset_normalizer-3.4.1-cp312-cp312-manylinux_2_17_x86_64.manylinux2014_x86_64.whl", hash = "sha256:bc2722592d8998c870fa4e290c2eec2c1569b87fe58618e67d38b4665dfa680d"}, + {file = "charset_normalizer-3.4.1-cp312-cp312-manylinux_2_5_i686.manylinux1_i686.manylinux_2_17_i686.manylinux2014_i686.whl", hash = "sha256:ffc9202a29ab3920fa812879e95a9e78b2465fd10be7fcbd042899695d75e616"}, + {file = "charset_normalizer-3.4.1-cp312-cp312-musllinux_1_2_aarch64.whl", hash = "sha256:804a4d582ba6e5b747c625bf1255e6b1507465494a40a2130978bda7b932c90b"}, + {file = "charset_normalizer-3.4.1-cp312-cp312-musllinux_1_2_i686.whl", hash = "sha256:0f55e69f030f7163dffe9fd0752b32f070566451afe180f99dbeeb81f511ad8d"}, + {file = "charset_normalizer-3.4.1-cp312-cp312-musllinux_1_2_ppc64le.whl", hash = "sha256:c4c3e6da02df6fa1410a7680bd3f63d4f710232d3139089536310d027950696a"}, + {file = "charset_normalizer-3.4.1-cp312-cp312-musllinux_1_2_s390x.whl", hash = "sha256:5df196eb874dae23dcfb968c83d4f8fdccb333330fe1fc278ac5ceeb101003a9"}, + {file = "charset_normalizer-3.4.1-cp312-cp312-musllinux_1_2_x86_64.whl", hash = "sha256:e358e64305fe12299a08e08978f51fc21fac060dcfcddd95453eabe5b93ed0e1"}, + {file = "charset_normalizer-3.4.1-cp312-cp312-win32.whl", hash = "sha256:9b23ca7ef998bc739bf6ffc077c2116917eabcc901f88da1b9856b210ef63f35"}, + {file = "charset_normalizer-3.4.1-cp312-cp312-win_amd64.whl", hash = "sha256:6ff8a4a60c227ad87030d76e99cd1698345d4491638dfa6673027c48b3cd395f"}, + {file = "charset_normalizer-3.4.1-cp313-cp313-macosx_10_13_universal2.whl", hash = "sha256:aabfa34badd18f1da5ec1bc2715cadc8dca465868a4e73a0173466b688f29dda"}, + {file = "charset_normalizer-3.4.1-cp313-cp313-manylinux_2_17_aarch64.manylinux2014_aarch64.whl", hash = "sha256:22e14b5d70560b8dd51ec22863f370d1e595ac3d024cb8ad7d308b4cd95f8313"}, + {file = "charset_normalizer-3.4.1-cp313-cp313-manylinux_2_17_ppc64le.manylinux2014_ppc64le.whl", hash = "sha256:8436c508b408b82d87dc5f62496973a1805cd46727c34440b0d29d8a2f50a6c9"}, + {file = "charset_normalizer-3.4.1-cp313-cp313-manylinux_2_17_s390x.manylinux2014_s390x.whl", hash = "sha256:2d074908e1aecee37a7635990b2c6d504cd4766c7bc9fc86d63f9c09af3fa11b"}, + {file = "charset_normalizer-3.4.1-cp313-cp313-manylinux_2_17_x86_64.manylinux2014_x86_64.whl", hash = "sha256:955f8851919303c92343d2f66165294848d57e9bba6cf6e3625485a70a038d11"}, + {file = "charset_normalizer-3.4.1-cp313-cp313-manylinux_2_5_i686.manylinux1_i686.manylinux_2_17_i686.manylinux2014_i686.whl", hash = "sha256:44ecbf16649486d4aebafeaa7ec4c9fed8b88101f4dd612dcaf65d5e815f837f"}, + {file = "charset_normalizer-3.4.1-cp313-cp313-musllinux_1_2_aarch64.whl", hash = "sha256:0924e81d3d5e70f8126529951dac65c1010cdf117bb75eb02dd12339b57749dd"}, + {file = "charset_normalizer-3.4.1-cp313-cp313-musllinux_1_2_i686.whl", hash = "sha256:2967f74ad52c3b98de4c3b32e1a44e32975e008a9cd2a8cc8966d6a5218c5cb2"}, + {file = "charset_normalizer-3.4.1-cp313-cp313-musllinux_1_2_ppc64le.whl", hash = "sha256:c75cb2a3e389853835e84a2d8fb2b81a10645b503eca9bcb98df6b5a43eb8886"}, + {file = "charset_normalizer-3.4.1-cp313-cp313-musllinux_1_2_s390x.whl", hash = "sha256:09b26ae6b1abf0d27570633b2b078a2a20419c99d66fb2823173d73f188ce601"}, + {file = "charset_normalizer-3.4.1-cp313-cp313-musllinux_1_2_x86_64.whl", hash = "sha256:fa88b843d6e211393a37219e6a1c1df99d35e8fd90446f1118f4216e307e48cd"}, + {file = "charset_normalizer-3.4.1-cp313-cp313-win32.whl", hash = "sha256:eb8178fe3dba6450a3e024e95ac49ed3400e506fd4e9e5c32d30adda88cbd407"}, + {file = "charset_normalizer-3.4.1-cp313-cp313-win_amd64.whl", hash = "sha256:b1ac5992a838106edb89654e0aebfc24f5848ae2547d22c2c3f66454daa11971"}, + {file = "charset_normalizer-3.4.1-cp37-cp37m-manylinux_2_17_aarch64.manylinux2014_aarch64.whl", hash = "sha256:f30bf9fd9be89ecb2360c7d94a711f00c09b976258846efe40db3d05828e8089"}, + {file = "charset_normalizer-3.4.1-cp37-cp37m-manylinux_2_17_ppc64le.manylinux2014_ppc64le.whl", hash = "sha256:97f68b8d6831127e4787ad15e6757232e14e12060bec17091b85eb1486b91d8d"}, + {file = "charset_normalizer-3.4.1-cp37-cp37m-manylinux_2_17_s390x.manylinux2014_s390x.whl", hash = "sha256:7974a0b5ecd505609e3b19742b60cee7aa2aa2fb3151bc917e6e2646d7667dcf"}, + {file = "charset_normalizer-3.4.1-cp37-cp37m-manylinux_2_17_x86_64.manylinux2014_x86_64.whl", hash = "sha256:fc54db6c8593ef7d4b2a331b58653356cf04f67c960f584edb7c3d8c97e8f39e"}, + {file = "charset_normalizer-3.4.1-cp37-cp37m-manylinux_2_5_i686.manylinux1_i686.manylinux_2_17_i686.manylinux2014_i686.whl", hash = "sha256:311f30128d7d333eebd7896965bfcfbd0065f1716ec92bd5638d7748eb6f936a"}, + {file = "charset_normalizer-3.4.1-cp37-cp37m-musllinux_1_2_aarch64.whl", hash = "sha256:7d053096f67cd1241601111b698f5cad775f97ab25d81567d3f59219b5f1adbd"}, + {file = "charset_normalizer-3.4.1-cp37-cp37m-musllinux_1_2_i686.whl", hash = "sha256:807f52c1f798eef6cf26beb819eeb8819b1622ddfeef9d0977a8502d4db6d534"}, + {file = "charset_normalizer-3.4.1-cp37-cp37m-musllinux_1_2_ppc64le.whl", hash = "sha256:dccbe65bd2f7f7ec22c4ff99ed56faa1e9f785482b9bbd7c717e26fd723a1d1e"}, + {file = "charset_normalizer-3.4.1-cp37-cp37m-musllinux_1_2_s390x.whl", hash = "sha256:2fb9bd477fdea8684f78791a6de97a953c51831ee2981f8e4f583ff3b9d9687e"}, + {file = "charset_normalizer-3.4.1-cp37-cp37m-musllinux_1_2_x86_64.whl", hash = "sha256:01732659ba9b5b873fc117534143e4feefecf3b2078b0a6a2e925271bb6f4cfa"}, + {file = "charset_normalizer-3.4.1-cp37-cp37m-win32.whl", hash = "sha256:7a4f97a081603d2050bfaffdefa5b02a9ec823f8348a572e39032caa8404a487"}, + {file = "charset_normalizer-3.4.1-cp37-cp37m-win_amd64.whl", hash = "sha256:7b1bef6280950ee6c177b326508f86cad7ad4dff12454483b51d8b7d673a2c5d"}, + {file = "charset_normalizer-3.4.1-cp38-cp38-macosx_10_9_universal2.whl", hash = "sha256:ecddf25bee22fe4fe3737a399d0d177d72bc22be6913acfab364b40bce1ba83c"}, + {file = "charset_normalizer-3.4.1-cp38-cp38-manylinux_2_17_aarch64.manylinux2014_aarch64.whl", hash = "sha256:8c60ca7339acd497a55b0ea5d506b2a2612afb2826560416f6894e8b5770d4a9"}, + {file = "charset_normalizer-3.4.1-cp38-cp38-manylinux_2_17_ppc64le.manylinux2014_ppc64le.whl", hash = "sha256:b7b2d86dd06bfc2ade3312a83a5c364c7ec2e3498f8734282c6c3d4b07b346b8"}, + {file = "charset_normalizer-3.4.1-cp38-cp38-manylinux_2_17_s390x.manylinux2014_s390x.whl", hash = "sha256:dd78cfcda14a1ef52584dbb008f7ac81c1328c0f58184bf9a84c49c605002da6"}, + {file = "charset_normalizer-3.4.1-cp38-cp38-manylinux_2_17_x86_64.manylinux2014_x86_64.whl", hash = "sha256:6e27f48bcd0957c6d4cb9d6fa6b61d192d0b13d5ef563e5f2ae35feafc0d179c"}, + {file = "charset_normalizer-3.4.1-cp38-cp38-manylinux_2_5_i686.manylinux1_i686.manylinux_2_17_i686.manylinux2014_i686.whl", hash = "sha256:01ad647cdd609225c5350561d084b42ddf732f4eeefe6e678765636791e78b9a"}, + {file = "charset_normalizer-3.4.1-cp38-cp38-musllinux_1_2_aarch64.whl", hash = "sha256:619a609aa74ae43d90ed2e89bdd784765de0a25ca761b93e196d938b8fd1dbbd"}, + {file = "charset_normalizer-3.4.1-cp38-cp38-musllinux_1_2_i686.whl", hash = "sha256:89149166622f4db9b4b6a449256291dc87a99ee53151c74cbd82a53c8c2f6ccd"}, + {file = "charset_normalizer-3.4.1-cp38-cp38-musllinux_1_2_ppc64le.whl", hash = "sha256:7709f51f5f7c853f0fb938bcd3bc59cdfdc5203635ffd18bf354f6967ea0f824"}, + {file = "charset_normalizer-3.4.1-cp38-cp38-musllinux_1_2_s390x.whl", hash = "sha256:345b0426edd4e18138d6528aed636de7a9ed169b4aaf9d61a8c19e39d26838ca"}, + {file = "charset_normalizer-3.4.1-cp38-cp38-musllinux_1_2_x86_64.whl", hash = "sha256:0907f11d019260cdc3f94fbdb23ff9125f6b5d1039b76003b5b0ac9d6a6c9d5b"}, + {file = "charset_normalizer-3.4.1-cp38-cp38-win32.whl", hash = "sha256:ea0d8d539afa5eb2728aa1932a988a9a7af94f18582ffae4bc10b3fbdad0626e"}, + {file = "charset_normalizer-3.4.1-cp38-cp38-win_amd64.whl", hash = "sha256:329ce159e82018d646c7ac45b01a430369d526569ec08516081727a20e9e4af4"}, + {file = "charset_normalizer-3.4.1-cp39-cp39-macosx_10_9_universal2.whl", hash = "sha256:b97e690a2118911e39b4042088092771b4ae3fc3aa86518f84b8cf6888dbdb41"}, + {file = "charset_normalizer-3.4.1-cp39-cp39-manylinux_2_17_aarch64.manylinux2014_aarch64.whl", hash = "sha256:78baa6d91634dfb69ec52a463534bc0df05dbd546209b79a3880a34487f4b84f"}, + {file = "charset_normalizer-3.4.1-cp39-cp39-manylinux_2_17_ppc64le.manylinux2014_ppc64le.whl", hash = "sha256:1a2bc9f351a75ef49d664206d51f8e5ede9da246602dc2d2726837620ea034b2"}, + {file = "charset_normalizer-3.4.1-cp39-cp39-manylinux_2_17_s390x.manylinux2014_s390x.whl", hash = "sha256:75832c08354f595c760a804588b9357d34ec00ba1c940c15e31e96d902093770"}, + {file = "charset_normalizer-3.4.1-cp39-cp39-manylinux_2_17_x86_64.manylinux2014_x86_64.whl", hash = "sha256:0af291f4fe114be0280cdd29d533696a77b5b49cfde5467176ecab32353395c4"}, + {file = "charset_normalizer-3.4.1-cp39-cp39-manylinux_2_5_i686.manylinux1_i686.manylinux_2_17_i686.manylinux2014_i686.whl", hash = "sha256:0167ddc8ab6508fe81860a57dd472b2ef4060e8d378f0cc555707126830f2537"}, + {file = "charset_normalizer-3.4.1-cp39-cp39-musllinux_1_2_aarch64.whl", hash = "sha256:2a75d49014d118e4198bcee5ee0a6f25856b29b12dbf7cd012791f8a6cc5c496"}, + {file = "charset_normalizer-3.4.1-cp39-cp39-musllinux_1_2_i686.whl", hash = "sha256:363e2f92b0f0174b2f8238240a1a30142e3db7b957a5dd5689b0e75fb717cc78"}, + {file = "charset_normalizer-3.4.1-cp39-cp39-musllinux_1_2_ppc64le.whl", hash = "sha256:ab36c8eb7e454e34e60eb55ca5d241a5d18b2c6244f6827a30e451c42410b5f7"}, + {file = "charset_normalizer-3.4.1-cp39-cp39-musllinux_1_2_s390x.whl", hash = "sha256:4c0907b1928a36d5a998d72d64d8eaa7244989f7aaaf947500d3a800c83a3fd6"}, + {file = "charset_normalizer-3.4.1-cp39-cp39-musllinux_1_2_x86_64.whl", hash = "sha256:04432ad9479fa40ec0f387795ddad4437a2b50417c69fa275e212933519ff294"}, + {file = "charset_normalizer-3.4.1-cp39-cp39-win32.whl", hash = "sha256:3bed14e9c89dcb10e8f3a29f9ccac4955aebe93c71ae803af79265c9ca5644c5"}, + {file = "charset_normalizer-3.4.1-cp39-cp39-win_amd64.whl", hash = "sha256:49402233c892a461407c512a19435d1ce275543138294f7ef013f0b63d5d3765"}, + {file = "charset_normalizer-3.4.1-py3-none-any.whl", hash = "sha256:d98b1668f06378c6dbefec3b92299716b931cd4e6061f3c875a71ced1780ab85"}, + {file = "charset_normalizer-3.4.1.tar.gz", hash = "sha256:44251f18cd68a75b56585dd00dae26183e102cd5e0f9f1466e6df5da2ed64ea3"}, ] [[package]] name = "click" -version = "8.1.7" +version = "8.1.8" description = "Composable command line interface toolkit" optional = false python-versions = ">=3.7" files = [ - {file = "click-8.1.7-py3-none-any.whl", hash = "sha256:ae74fb96c20a0277a1d615f1e4d73c8414f5a98db8b799a7931d1582f3390c28"}, - {file = "click-8.1.7.tar.gz", hash = "sha256:ca9853ad459e787e2192211578cc907e7594e294c7ccc834310722b41b9ca6de"}, + {file = "click-8.1.8-py3-none-any.whl", hash = "sha256:63c132bbbed01578a06712a2d1f497bb62d9c1c0d329b7903a866228027263b2"}, + {file = "click-8.1.8.tar.gz", hash = "sha256:ed53c9d8990d83c2a27deae68e4ee337473f6330c040a31d4225c9574d16096a"}, ] [package.dependencies] @@ -196,73 +183,73 @@ files = [ [[package]] name = "coverage" -version = "7.6.8" +version = "7.6.9" description = "Code coverage measurement for Python" optional = false python-versions = ">=3.9" files = [ - {file = "coverage-7.6.8-cp310-cp310-macosx_10_9_x86_64.whl", hash = "sha256:b39e6011cd06822eb964d038d5dff5da5d98652b81f5ecd439277b32361a3a50"}, - {file = "coverage-7.6.8-cp310-cp310-macosx_11_0_arm64.whl", hash = "sha256:63c19702db10ad79151a059d2d6336fe0c470f2e18d0d4d1a57f7f9713875dcf"}, - {file = "coverage-7.6.8-cp310-cp310-manylinux_2_17_aarch64.manylinux2014_aarch64.whl", hash = "sha256:3985b9be361d8fb6b2d1adc9924d01dec575a1d7453a14cccd73225cb79243ee"}, - {file = "coverage-7.6.8-cp310-cp310-manylinux_2_5_i686.manylinux1_i686.manylinux_2_17_i686.manylinux2014_i686.whl", hash = "sha256:644ec81edec0f4ad17d51c838a7d01e42811054543b76d4ba2c5d6af741ce2a6"}, - {file = "coverage-7.6.8-cp310-cp310-manylinux_2_5_x86_64.manylinux1_x86_64.manylinux_2_17_x86_64.manylinux2014_x86_64.whl", hash = "sha256:1f188a2402f8359cf0c4b1fe89eea40dc13b52e7b4fd4812450da9fcd210181d"}, - {file = "coverage-7.6.8-cp310-cp310-musllinux_1_2_aarch64.whl", hash = "sha256:e19122296822deafce89a0c5e8685704c067ae65d45e79718c92df7b3ec3d331"}, - {file = "coverage-7.6.8-cp310-cp310-musllinux_1_2_i686.whl", hash = "sha256:13618bed0c38acc418896005732e565b317aa9e98d855a0e9f211a7ffc2d6638"}, - {file = "coverage-7.6.8-cp310-cp310-musllinux_1_2_x86_64.whl", hash = "sha256:193e3bffca48ad74b8c764fb4492dd875038a2f9925530cb094db92bb5e47bed"}, - {file = "coverage-7.6.8-cp310-cp310-win32.whl", hash = "sha256:3988665ee376abce49613701336544041f2117de7b7fbfe91b93d8ff8b151c8e"}, - {file = "coverage-7.6.8-cp310-cp310-win_amd64.whl", hash = "sha256:f56f49b2553d7dd85fd86e029515a221e5c1f8cb3d9c38b470bc38bde7b8445a"}, - {file = "coverage-7.6.8-cp311-cp311-macosx_10_9_x86_64.whl", hash = "sha256:86cffe9c6dfcfe22e28027069725c7f57f4b868a3f86e81d1c62462764dc46d4"}, - {file = "coverage-7.6.8-cp311-cp311-macosx_11_0_arm64.whl", hash = "sha256:d82ab6816c3277dc962cfcdc85b1efa0e5f50fb2c449432deaf2398a2928ab94"}, - {file = "coverage-7.6.8-cp311-cp311-manylinux_2_17_aarch64.manylinux2014_aarch64.whl", hash = "sha256:13690e923a3932e4fad4c0ebfb9cb5988e03d9dcb4c5150b5fcbf58fd8bddfc4"}, - {file = "coverage-7.6.8-cp311-cp311-manylinux_2_5_i686.manylinux1_i686.manylinux_2_17_i686.manylinux2014_i686.whl", hash = "sha256:4be32da0c3827ac9132bb488d331cb32e8d9638dd41a0557c5569d57cf22c9c1"}, - {file = "coverage-7.6.8-cp311-cp311-manylinux_2_5_x86_64.manylinux1_x86_64.manylinux_2_17_x86_64.manylinux2014_x86_64.whl", hash = "sha256:44e6c85bbdc809383b509d732b06419fb4544dca29ebe18480379633623baafb"}, - {file = "coverage-7.6.8-cp311-cp311-musllinux_1_2_aarch64.whl", hash = "sha256:768939f7c4353c0fac2f7c37897e10b1414b571fd85dd9fc49e6a87e37a2e0d8"}, - {file = "coverage-7.6.8-cp311-cp311-musllinux_1_2_i686.whl", hash = "sha256:e44961e36cb13c495806d4cac67640ac2866cb99044e210895b506c26ee63d3a"}, - {file = "coverage-7.6.8-cp311-cp311-musllinux_1_2_x86_64.whl", hash = "sha256:3ea8bb1ab9558374c0ab591783808511d135a833c3ca64a18ec927f20c4030f0"}, - {file = "coverage-7.6.8-cp311-cp311-win32.whl", hash = "sha256:629a1ba2115dce8bf75a5cce9f2486ae483cb89c0145795603d6554bdc83e801"}, - {file = "coverage-7.6.8-cp311-cp311-win_amd64.whl", hash = "sha256:fb9fc32399dca861584d96eccd6c980b69bbcd7c228d06fb74fe53e007aa8ef9"}, - {file = "coverage-7.6.8-cp312-cp312-macosx_10_13_x86_64.whl", hash = "sha256:e683e6ecc587643f8cde8f5da6768e9d165cd31edf39ee90ed7034f9ca0eefee"}, - {file = "coverage-7.6.8-cp312-cp312-macosx_11_0_arm64.whl", hash = "sha256:1defe91d41ce1bd44b40fabf071e6a01a5aa14de4a31b986aa9dfd1b3e3e414a"}, - {file = "coverage-7.6.8-cp312-cp312-manylinux_2_17_aarch64.manylinux2014_aarch64.whl", hash = "sha256:d7ad66e8e50225ebf4236368cc43c37f59d5e6728f15f6e258c8639fa0dd8e6d"}, - {file = "coverage-7.6.8-cp312-cp312-manylinux_2_5_i686.manylinux1_i686.manylinux_2_17_i686.manylinux2014_i686.whl", hash = "sha256:3fe47da3e4fda5f1abb5709c156eca207eacf8007304ce3019eb001e7a7204cb"}, - {file = "coverage-7.6.8-cp312-cp312-manylinux_2_5_x86_64.manylinux1_x86_64.manylinux_2_17_x86_64.manylinux2014_x86_64.whl", hash = "sha256:202a2d645c5a46b84992f55b0a3affe4f0ba6b4c611abec32ee88358db4bb649"}, - {file = "coverage-7.6.8-cp312-cp312-musllinux_1_2_aarch64.whl", hash = "sha256:4674f0daa1823c295845b6a740d98a840d7a1c11df00d1fd62614545c1583787"}, - {file = "coverage-7.6.8-cp312-cp312-musllinux_1_2_i686.whl", hash = "sha256:74610105ebd6f33d7c10f8907afed696e79c59e3043c5f20eaa3a46fddf33b4c"}, - {file = "coverage-7.6.8-cp312-cp312-musllinux_1_2_x86_64.whl", hash = "sha256:37cda8712145917105e07aab96388ae76e787270ec04bcb9d5cc786d7cbb8443"}, - {file = "coverage-7.6.8-cp312-cp312-win32.whl", hash = "sha256:9e89d5c8509fbd6c03d0dd1972925b22f50db0792ce06324ba069f10787429ad"}, - {file = "coverage-7.6.8-cp312-cp312-win_amd64.whl", hash = "sha256:379c111d3558272a2cae3d8e57e6b6e6f4fe652905692d54bad5ea0ca37c5ad4"}, - {file = "coverage-7.6.8-cp313-cp313-macosx_10_13_x86_64.whl", hash = "sha256:0b0c69f4f724c64dfbfe79f5dfb503b42fe6127b8d479b2677f2b227478db2eb"}, - {file = "coverage-7.6.8-cp313-cp313-macosx_11_0_arm64.whl", hash = "sha256:c15b32a7aca8038ed7644f854bf17b663bc38e1671b5d6f43f9a2b2bd0c46f63"}, - {file = "coverage-7.6.8-cp313-cp313-manylinux_2_17_aarch64.manylinux2014_aarch64.whl", hash = "sha256:63068a11171e4276f6ece913bde059e77c713b48c3a848814a6537f35afb8365"}, - {file = "coverage-7.6.8-cp313-cp313-manylinux_2_5_i686.manylinux1_i686.manylinux_2_17_i686.manylinux2014_i686.whl", hash = "sha256:6f4548c5ead23ad13fb7a2c8ea541357474ec13c2b736feb02e19a3085fac002"}, - {file = "coverage-7.6.8-cp313-cp313-manylinux_2_5_x86_64.manylinux1_x86_64.manylinux_2_17_x86_64.manylinux2014_x86_64.whl", hash = "sha256:3b4b4299dd0d2c67caaaf286d58aef5e75b125b95615dda4542561a5a566a1e3"}, - {file = "coverage-7.6.8-cp313-cp313-musllinux_1_2_aarch64.whl", hash = "sha256:c9ebfb2507751f7196995142f057d1324afdab56db1d9743aab7f50289abd022"}, - {file = "coverage-7.6.8-cp313-cp313-musllinux_1_2_i686.whl", hash = "sha256:c1b4474beee02ede1eef86c25ad4600a424fe36cff01a6103cb4533c6bf0169e"}, - {file = "coverage-7.6.8-cp313-cp313-musllinux_1_2_x86_64.whl", hash = "sha256:d9fd2547e6decdbf985d579cf3fc78e4c1d662b9b0ff7cc7862baaab71c9cc5b"}, - {file = "coverage-7.6.8-cp313-cp313-win32.whl", hash = "sha256:8aae5aea53cbfe024919715eca696b1a3201886ce83790537d1c3668459c7146"}, - {file = "coverage-7.6.8-cp313-cp313-win_amd64.whl", hash = "sha256:ae270e79f7e169ccfe23284ff5ea2d52a6f401dc01b337efb54b3783e2ce3f28"}, - {file = "coverage-7.6.8-cp313-cp313t-macosx_10_13_x86_64.whl", hash = "sha256:de38add67a0af869b0d79c525d3e4588ac1ffa92f39116dbe0ed9753f26eba7d"}, - {file = "coverage-7.6.8-cp313-cp313t-macosx_11_0_arm64.whl", hash = "sha256:b07c25d52b1c16ce5de088046cd2432b30f9ad5e224ff17c8f496d9cb7d1d451"}, - {file = "coverage-7.6.8-cp313-cp313t-manylinux_2_17_aarch64.manylinux2014_aarch64.whl", hash = "sha256:62a66ff235e4c2e37ed3b6104d8b478d767ff73838d1222132a7a026aa548764"}, - {file = "coverage-7.6.8-cp313-cp313t-manylinux_2_5_i686.manylinux1_i686.manylinux_2_17_i686.manylinux2014_i686.whl", hash = "sha256:09b9f848b28081e7b975a3626e9081574a7b9196cde26604540582da60235fdf"}, - {file = "coverage-7.6.8-cp313-cp313t-manylinux_2_5_x86_64.manylinux1_x86_64.manylinux_2_17_x86_64.manylinux2014_x86_64.whl", hash = "sha256:093896e530c38c8e9c996901858ac63f3d4171268db2c9c8b373a228f459bbc5"}, - {file = "coverage-7.6.8-cp313-cp313t-musllinux_1_2_aarch64.whl", hash = "sha256:9a7b8ac36fd688c8361cbc7bf1cb5866977ece6e0b17c34aa0df58bda4fa18a4"}, - {file = "coverage-7.6.8-cp313-cp313t-musllinux_1_2_i686.whl", hash = "sha256:38c51297b35b3ed91670e1e4efb702b790002e3245a28c76e627478aa3c10d83"}, - {file = "coverage-7.6.8-cp313-cp313t-musllinux_1_2_x86_64.whl", hash = "sha256:2e4e0f60cb4bd7396108823548e82fdab72d4d8a65e58e2c19bbbc2f1e2bfa4b"}, - {file = "coverage-7.6.8-cp313-cp313t-win32.whl", hash = "sha256:6535d996f6537ecb298b4e287a855f37deaf64ff007162ec0afb9ab8ba3b8b71"}, - {file = "coverage-7.6.8-cp313-cp313t-win_amd64.whl", hash = "sha256:c79c0685f142ca53256722a384540832420dff4ab15fec1863d7e5bc8691bdcc"}, - {file = "coverage-7.6.8-cp39-cp39-macosx_10_9_x86_64.whl", hash = "sha256:3ac47fa29d8d41059ea3df65bd3ade92f97ee4910ed638e87075b8e8ce69599e"}, - {file = "coverage-7.6.8-cp39-cp39-macosx_11_0_arm64.whl", hash = "sha256:24eda3a24a38157eee639ca9afe45eefa8d2420d49468819ac5f88b10de84f4c"}, - {file = "coverage-7.6.8-cp39-cp39-manylinux_2_17_aarch64.manylinux2014_aarch64.whl", hash = "sha256:e4c81ed2820b9023a9a90717020315e63b17b18c274a332e3b6437d7ff70abe0"}, - {file = "coverage-7.6.8-cp39-cp39-manylinux_2_5_i686.manylinux1_i686.manylinux_2_17_i686.manylinux2014_i686.whl", hash = "sha256:bd55f8fc8fa494958772a2a7302b0354ab16e0b9272b3c3d83cdb5bec5bd1779"}, - {file = "coverage-7.6.8-cp39-cp39-manylinux_2_5_x86_64.manylinux1_x86_64.manylinux_2_17_x86_64.manylinux2014_x86_64.whl", hash = "sha256:f39e2f3530ed1626c66e7493be7a8423b023ca852aacdc91fb30162c350d2a92"}, - {file = "coverage-7.6.8-cp39-cp39-musllinux_1_2_aarch64.whl", hash = "sha256:716a78a342679cd1177bc8c2fe957e0ab91405bd43a17094324845200b2fddf4"}, - {file = "coverage-7.6.8-cp39-cp39-musllinux_1_2_i686.whl", hash = "sha256:177f01eeaa3aee4a5ffb0d1439c5952b53d5010f86e9d2667963e632e30082cc"}, - {file = "coverage-7.6.8-cp39-cp39-musllinux_1_2_x86_64.whl", hash = "sha256:912e95017ff51dc3d7b6e2be158dedc889d9a5cc3382445589ce554f1a34c0ea"}, - {file = "coverage-7.6.8-cp39-cp39-win32.whl", hash = "sha256:4db3ed6a907b555e57cc2e6f14dc3a4c2458cdad8919e40b5357ab9b6db6c43e"}, - {file = "coverage-7.6.8-cp39-cp39-win_amd64.whl", hash = "sha256:428ac484592f780e8cd7b6b14eb568f7c85460c92e2a37cb0c0e5186e1a0d076"}, - {file = "coverage-7.6.8-pp39.pp310-none-any.whl", hash = "sha256:5c52a036535d12590c32c49209e79cabaad9f9ad8aa4cbd875b68c4d67a9cbce"}, - {file = "coverage-7.6.8.tar.gz", hash = "sha256:8b2b8503edb06822c86d82fa64a4a5cb0760bb8f31f26e138ec743f422f37cfc"}, + {file = "coverage-7.6.9-cp310-cp310-macosx_10_9_x86_64.whl", hash = "sha256:85d9636f72e8991a1706b2b55b06c27545448baf9f6dbf51c4004609aacd7dcb"}, + {file = "coverage-7.6.9-cp310-cp310-macosx_11_0_arm64.whl", hash = "sha256:608a7fd78c67bee8936378299a6cb9f5149bb80238c7a566fc3e6717a4e68710"}, + {file = "coverage-7.6.9-cp310-cp310-manylinux_2_17_aarch64.manylinux2014_aarch64.whl", hash = "sha256:96d636c77af18b5cb664ddf12dab9b15a0cfe9c0bde715da38698c8cea748bfa"}, + {file = "coverage-7.6.9-cp310-cp310-manylinux_2_5_i686.manylinux1_i686.manylinux_2_17_i686.manylinux2014_i686.whl", hash = "sha256:d75cded8a3cff93da9edc31446872d2997e327921d8eed86641efafd350e1df1"}, + {file = "coverage-7.6.9-cp310-cp310-manylinux_2_5_x86_64.manylinux1_x86_64.manylinux_2_17_x86_64.manylinux2014_x86_64.whl", hash = "sha256:f7b15f589593110ae767ce997775d645b47e5cbbf54fd322f8ebea6277466cec"}, + {file = "coverage-7.6.9-cp310-cp310-musllinux_1_2_aarch64.whl", hash = "sha256:44349150f6811b44b25574839b39ae35291f6496eb795b7366fef3bd3cf112d3"}, + {file = "coverage-7.6.9-cp310-cp310-musllinux_1_2_i686.whl", hash = "sha256:d891c136b5b310d0e702e186d70cd16d1119ea8927347045124cb286b29297e5"}, + {file = "coverage-7.6.9-cp310-cp310-musllinux_1_2_x86_64.whl", hash = "sha256:db1dab894cc139f67822a92910466531de5ea6034ddfd2b11c0d4c6257168073"}, + {file = "coverage-7.6.9-cp310-cp310-win32.whl", hash = "sha256:41ff7b0da5af71a51b53f501a3bac65fb0ec311ebed1632e58fc6107f03b9198"}, + {file = "coverage-7.6.9-cp310-cp310-win_amd64.whl", hash = "sha256:35371f8438028fdccfaf3570b31d98e8d9eda8bb1d6ab9473f5a390969e98717"}, + {file = "coverage-7.6.9-cp311-cp311-macosx_10_9_x86_64.whl", hash = "sha256:932fc826442132dde42ee52cf66d941f581c685a6313feebed358411238f60f9"}, + {file = "coverage-7.6.9-cp311-cp311-macosx_11_0_arm64.whl", hash = "sha256:085161be5f3b30fd9b3e7b9a8c301f935c8313dcf928a07b116324abea2c1c2c"}, + {file = "coverage-7.6.9-cp311-cp311-manylinux_2_17_aarch64.manylinux2014_aarch64.whl", hash = "sha256:ccc660a77e1c2bf24ddbce969af9447a9474790160cfb23de6be4fa88e3951c7"}, + {file = "coverage-7.6.9-cp311-cp311-manylinux_2_5_i686.manylinux1_i686.manylinux_2_17_i686.manylinux2014_i686.whl", hash = "sha256:c69e42c892c018cd3c8d90da61d845f50a8243062b19d228189b0224150018a9"}, + {file = "coverage-7.6.9-cp311-cp311-manylinux_2_5_x86_64.manylinux1_x86_64.manylinux_2_17_x86_64.manylinux2014_x86_64.whl", hash = "sha256:0824a28ec542a0be22f60c6ac36d679e0e262e5353203bea81d44ee81fe9c6d4"}, + {file = "coverage-7.6.9-cp311-cp311-musllinux_1_2_aarch64.whl", hash = "sha256:4401ae5fc52ad8d26d2a5d8a7428b0f0c72431683f8e63e42e70606374c311a1"}, + {file = "coverage-7.6.9-cp311-cp311-musllinux_1_2_i686.whl", hash = "sha256:98caba4476a6c8d59ec1eb00c7dd862ba9beca34085642d46ed503cc2d440d4b"}, + {file = "coverage-7.6.9-cp311-cp311-musllinux_1_2_x86_64.whl", hash = "sha256:ee5defd1733fd6ec08b168bd4f5387d5b322f45ca9e0e6c817ea6c4cd36313e3"}, + {file = "coverage-7.6.9-cp311-cp311-win32.whl", hash = "sha256:f2d1ec60d6d256bdf298cb86b78dd715980828f50c46701abc3b0a2b3f8a0dc0"}, + {file = "coverage-7.6.9-cp311-cp311-win_amd64.whl", hash = "sha256:0d59fd927b1f04de57a2ba0137166d31c1a6dd9e764ad4af552912d70428c92b"}, + {file = "coverage-7.6.9-cp312-cp312-macosx_10_13_x86_64.whl", hash = "sha256:99e266ae0b5d15f1ca8d278a668df6f51cc4b854513daab5cae695ed7b721cf8"}, + {file = "coverage-7.6.9-cp312-cp312-macosx_11_0_arm64.whl", hash = "sha256:9901d36492009a0a9b94b20e52ebfc8453bf49bb2b27bca2c9706f8b4f5a554a"}, + {file = "coverage-7.6.9-cp312-cp312-manylinux_2_17_aarch64.manylinux2014_aarch64.whl", hash = "sha256:abd3e72dd5b97e3af4246cdada7738ef0e608168de952b837b8dd7e90341f015"}, + {file = "coverage-7.6.9-cp312-cp312-manylinux_2_5_i686.manylinux1_i686.manylinux_2_17_i686.manylinux2014_i686.whl", hash = "sha256:ff74026a461eb0660366fb01c650c1d00f833a086b336bdad7ab00cc952072b3"}, + {file = "coverage-7.6.9-cp312-cp312-manylinux_2_5_x86_64.manylinux1_x86_64.manylinux_2_17_x86_64.manylinux2014_x86_64.whl", hash = "sha256:65dad5a248823a4996724a88eb51d4b31587aa7aa428562dbe459c684e5787ae"}, + {file = "coverage-7.6.9-cp312-cp312-musllinux_1_2_aarch64.whl", hash = "sha256:22be16571504c9ccea919fcedb459d5ab20d41172056206eb2994e2ff06118a4"}, + {file = "coverage-7.6.9-cp312-cp312-musllinux_1_2_i686.whl", hash = "sha256:0f957943bc718b87144ecaee70762bc2bc3f1a7a53c7b861103546d3a403f0a6"}, + {file = "coverage-7.6.9-cp312-cp312-musllinux_1_2_x86_64.whl", hash = "sha256:0ae1387db4aecb1f485fb70a6c0148c6cdaebb6038f1d40089b1fc84a5db556f"}, + {file = "coverage-7.6.9-cp312-cp312-win32.whl", hash = "sha256:1a330812d9cc7ac2182586f6d41b4d0fadf9be9049f350e0efb275c8ee8eb692"}, + {file = "coverage-7.6.9-cp312-cp312-win_amd64.whl", hash = "sha256:b12c6b18269ca471eedd41c1b6a1065b2f7827508edb9a7ed5555e9a56dcfc97"}, + {file = "coverage-7.6.9-cp313-cp313-macosx_10_13_x86_64.whl", hash = "sha256:899b8cd4781c400454f2f64f7776a5d87bbd7b3e7f7bda0cb18f857bb1334664"}, + {file = "coverage-7.6.9-cp313-cp313-macosx_11_0_arm64.whl", hash = "sha256:61f70dc68bd36810972e55bbbe83674ea073dd1dcc121040a08cdf3416c5349c"}, + {file = "coverage-7.6.9-cp313-cp313-manylinux_2_17_aarch64.manylinux2014_aarch64.whl", hash = "sha256:8a289d23d4c46f1a82d5db4abeb40b9b5be91731ee19a379d15790e53031c014"}, + {file = "coverage-7.6.9-cp313-cp313-manylinux_2_5_i686.manylinux1_i686.manylinux_2_17_i686.manylinux2014_i686.whl", hash = "sha256:7e216d8044a356fc0337c7a2a0536d6de07888d7bcda76febcb8adc50bdbbd00"}, + {file = "coverage-7.6.9-cp313-cp313-manylinux_2_5_x86_64.manylinux1_x86_64.manylinux_2_17_x86_64.manylinux2014_x86_64.whl", hash = "sha256:3c026eb44f744acaa2bda7493dad903aa5bf5fc4f2554293a798d5606710055d"}, + {file = "coverage-7.6.9-cp313-cp313-musllinux_1_2_aarch64.whl", hash = "sha256:e77363e8425325384f9d49272c54045bbed2f478e9dd698dbc65dbc37860eb0a"}, + {file = "coverage-7.6.9-cp313-cp313-musllinux_1_2_i686.whl", hash = "sha256:777abfab476cf83b5177b84d7486497e034eb9eaea0d746ce0c1268c71652077"}, + {file = "coverage-7.6.9-cp313-cp313-musllinux_1_2_x86_64.whl", hash = "sha256:447af20e25fdbe16f26e84eb714ba21d98868705cb138252d28bc400381f6ffb"}, + {file = "coverage-7.6.9-cp313-cp313-win32.whl", hash = "sha256:d872ec5aeb086cbea771c573600d47944eea2dcba8be5f3ee649bfe3cb8dc9ba"}, + {file = "coverage-7.6.9-cp313-cp313-win_amd64.whl", hash = "sha256:fd1213c86e48dfdc5a0cc676551db467495a95a662d2396ecd58e719191446e1"}, + {file = "coverage-7.6.9-cp313-cp313t-macosx_10_13_x86_64.whl", hash = "sha256:ba9e7484d286cd5a43744e5f47b0b3fb457865baf07bafc6bee91896364e1419"}, + {file = "coverage-7.6.9-cp313-cp313t-macosx_11_0_arm64.whl", hash = "sha256:e5ea1cf0872ee455c03e5674b5bca5e3e68e159379c1af0903e89f5eba9ccc3a"}, + {file = "coverage-7.6.9-cp313-cp313t-manylinux_2_17_aarch64.manylinux2014_aarch64.whl", hash = "sha256:2d10e07aa2b91835d6abec555ec8b2733347956991901eea6ffac295f83a30e4"}, + {file = "coverage-7.6.9-cp313-cp313t-manylinux_2_5_i686.manylinux1_i686.manylinux_2_17_i686.manylinux2014_i686.whl", hash = "sha256:13a9e2d3ee855db3dd6ea1ba5203316a1b1fd8eaeffc37c5b54987e61e4194ae"}, + {file = "coverage-7.6.9-cp313-cp313t-manylinux_2_5_x86_64.manylinux1_x86_64.manylinux_2_17_x86_64.manylinux2014_x86_64.whl", hash = "sha256:9c38bf15a40ccf5619fa2fe8f26106c7e8e080d7760aeccb3722664c8656b030"}, + {file = "coverage-7.6.9-cp313-cp313t-musllinux_1_2_aarch64.whl", hash = "sha256:d5275455b3e4627c8e7154feaf7ee0743c2e7af82f6e3b561967b1cca755a0be"}, + {file = "coverage-7.6.9-cp313-cp313t-musllinux_1_2_i686.whl", hash = "sha256:8f8770dfc6e2c6a2d4569f411015c8d751c980d17a14b0530da2d7f27ffdd88e"}, + {file = "coverage-7.6.9-cp313-cp313t-musllinux_1_2_x86_64.whl", hash = "sha256:8d2dfa71665a29b153a9681edb1c8d9c1ea50dfc2375fb4dac99ea7e21a0bcd9"}, + {file = "coverage-7.6.9-cp313-cp313t-win32.whl", hash = "sha256:5e6b86b5847a016d0fbd31ffe1001b63355ed309651851295315031ea7eb5a9b"}, + {file = "coverage-7.6.9-cp313-cp313t-win_amd64.whl", hash = "sha256:97ddc94d46088304772d21b060041c97fc16bdda13c6c7f9d8fcd8d5ae0d8611"}, + {file = "coverage-7.6.9-cp39-cp39-macosx_10_9_x86_64.whl", hash = "sha256:adb697c0bd35100dc690de83154627fbab1f4f3c0386df266dded865fc50a902"}, + {file = "coverage-7.6.9-cp39-cp39-macosx_11_0_arm64.whl", hash = "sha256:be57b6d56e49c2739cdf776839a92330e933dd5e5d929966fbbd380c77f060be"}, + {file = "coverage-7.6.9-cp39-cp39-manylinux_2_17_aarch64.manylinux2014_aarch64.whl", hash = "sha256:f1592791f8204ae9166de22ba7e6705fa4ebd02936c09436a1bb85aabca3e599"}, + {file = "coverage-7.6.9-cp39-cp39-manylinux_2_5_i686.manylinux1_i686.manylinux_2_17_i686.manylinux2014_i686.whl", hash = "sha256:4e12ae8cc979cf83d258acb5e1f1cf2f3f83524d1564a49d20b8bec14b637f08"}, + {file = "coverage-7.6.9-cp39-cp39-manylinux_2_5_x86_64.manylinux1_x86_64.manylinux_2_17_x86_64.manylinux2014_x86_64.whl", hash = "sha256:bb5555cff66c4d3d6213a296b360f9e1a8e323e74e0426b6c10ed7f4d021e464"}, + {file = "coverage-7.6.9-cp39-cp39-musllinux_1_2_aarch64.whl", hash = "sha256:b9389a429e0e5142e69d5bf4a435dd688c14478a19bb901735cdf75e57b13845"}, + {file = "coverage-7.6.9-cp39-cp39-musllinux_1_2_i686.whl", hash = "sha256:592ac539812e9b46046620341498caf09ca21023c41c893e1eb9dbda00a70cbf"}, + {file = "coverage-7.6.9-cp39-cp39-musllinux_1_2_x86_64.whl", hash = "sha256:a27801adef24cc30871da98a105f77995e13a25a505a0161911f6aafbd66e678"}, + {file = "coverage-7.6.9-cp39-cp39-win32.whl", hash = "sha256:8e3c3e38930cfb729cb8137d7f055e5a473ddaf1217966aa6238c88bd9fd50e6"}, + {file = "coverage-7.6.9-cp39-cp39-win_amd64.whl", hash = "sha256:e28bf44afa2b187cc9f41749138a64435bf340adfcacb5b2290c070ce99839d4"}, + {file = "coverage-7.6.9-pp39.pp310-none-any.whl", hash = "sha256:f3ca78518bc6bc92828cd11867b121891d75cae4ea9e908d72030609b996db1b"}, + {file = "coverage-7.6.9.tar.gz", hash = "sha256:4a8d8977b0c6ef5aeadcb644da9e69ae0dcfe66ec7f368c89c72e058bd71164d"}, ] [package.dependencies] @@ -366,13 +353,13 @@ files = [ [[package]] name = "jinja2" -version = "3.1.4" +version = "3.1.5" description = "A very fast and expressive template engine." optional = false python-versions = ">=3.7" files = [ - {file = "jinja2-3.1.4-py3-none-any.whl", hash = "sha256:bc5dd2abb727a5319567b7a813e6a2e7318c39f4f487cfe6c89c6f9c7d25197d"}, - {file = "jinja2-3.1.4.tar.gz", hash = "sha256:4a3aee7acbbe7303aede8e9648d13b8bf88a429282aa6122a993f0ac800cb369"}, + {file = "jinja2-3.1.5-py3-none-any.whl", hash = "sha256:aba0f4dc9ed8013c424088f68a5c226f7d6097ed89b246d7749c2ec4175c6adb"}, + {file = "jinja2-3.1.5.tar.gz", hash = "sha256:8fefff8dc3034e27bb80d67c671eb8a9bc424c0ef4c0826edbff304cceff43bb"}, ] [package.dependencies] @@ -592,13 +579,13 @@ mkdocs = ">=1.0.3" [[package]] name = "mkdocs-material" -version = "9.5.47" +version = "9.5.49" description = "Documentation that simply works" optional = false python-versions = ">=3.8" files = [ - {file = "mkdocs_material-9.5.47-py3-none-any.whl", hash = "sha256:53fb9c9624e7865da6ec807d116cd7be24b3cb36ab31b1d1d1a9af58c56009a2"}, - {file = "mkdocs_material-9.5.47.tar.gz", hash = "sha256:fc3b7a8e00ad896660bd3a5cc12ca0cb28bdc2bcbe2a946b5714c23ac91b0ede"}, + {file = "mkdocs_material-9.5.49-py3-none-any.whl", hash = "sha256:c3c2d8176b18198435d3a3e119011922f3e11424074645c24019c2dcf08a360e"}, + {file = "mkdocs_material-9.5.49.tar.gz", hash = "sha256:3671bb282b4f53a1c72e08adbe04d2481a98f85fed392530051f80ff94a9621d"}, ] [package.dependencies] @@ -707,49 +694,49 @@ mkdocstrings = ">=0.26" [[package]] name = "mypy" -version = "1.13.0" +version = "1.14.0" description = "Optional static typing for Python" optional = false python-versions = ">=3.8" files = [ - {file = "mypy-1.13.0-cp310-cp310-macosx_10_9_x86_64.whl", hash = "sha256:6607e0f1dd1fb7f0aca14d936d13fd19eba5e17e1cd2a14f808fa5f8f6d8f60a"}, - {file = "mypy-1.13.0-cp310-cp310-macosx_11_0_arm64.whl", hash = "sha256:8a21be69bd26fa81b1f80a61ee7ab05b076c674d9b18fb56239d72e21d9f4c80"}, - {file = "mypy-1.13.0-cp310-cp310-manylinux_2_17_x86_64.manylinux2014_x86_64.manylinux_2_28_x86_64.whl", hash = "sha256:7b2353a44d2179846a096e25691d54d59904559f4232519d420d64da6828a3a7"}, - {file = "mypy-1.13.0-cp310-cp310-musllinux_1_1_x86_64.whl", hash = "sha256:0730d1c6a2739d4511dc4253f8274cdd140c55c32dfb0a4cf8b7a43f40abfa6f"}, - {file = "mypy-1.13.0-cp310-cp310-win_amd64.whl", hash = "sha256:c5fc54dbb712ff5e5a0fca797e6e0aa25726c7e72c6a5850cfd2adbc1eb0a372"}, - {file = "mypy-1.13.0-cp311-cp311-macosx_10_9_x86_64.whl", hash = "sha256:581665e6f3a8a9078f28d5502f4c334c0c8d802ef55ea0e7276a6e409bc0d82d"}, - {file = "mypy-1.13.0-cp311-cp311-macosx_11_0_arm64.whl", hash = "sha256:3ddb5b9bf82e05cc9a627e84707b528e5c7caaa1c55c69e175abb15a761cec2d"}, - {file = "mypy-1.13.0-cp311-cp311-manylinux_2_17_x86_64.manylinux2014_x86_64.manylinux_2_28_x86_64.whl", hash = "sha256:20c7ee0bc0d5a9595c46f38beb04201f2620065a93755704e141fcac9f59db2b"}, - {file = "mypy-1.13.0-cp311-cp311-musllinux_1_1_x86_64.whl", hash = "sha256:3790ded76f0b34bc9c8ba4def8f919dd6a46db0f5a6610fb994fe8efdd447f73"}, - {file = "mypy-1.13.0-cp311-cp311-win_amd64.whl", hash = "sha256:51f869f4b6b538229c1d1bcc1dd7d119817206e2bc54e8e374b3dfa202defcca"}, - {file = "mypy-1.13.0-cp312-cp312-macosx_10_13_x86_64.whl", hash = "sha256:5c7051a3461ae84dfb5dd15eff5094640c61c5f22257c8b766794e6dd85e72d5"}, - {file = "mypy-1.13.0-cp312-cp312-macosx_11_0_arm64.whl", hash = "sha256:39bb21c69a5d6342f4ce526e4584bc5c197fd20a60d14a8624d8743fffb9472e"}, - {file = "mypy-1.13.0-cp312-cp312-manylinux_2_17_x86_64.manylinux2014_x86_64.manylinux_2_28_x86_64.whl", hash = "sha256:164f28cb9d6367439031f4c81e84d3ccaa1e19232d9d05d37cb0bd880d3f93c2"}, - {file = "mypy-1.13.0-cp312-cp312-musllinux_1_1_x86_64.whl", hash = "sha256:a4c1bfcdbce96ff5d96fc9b08e3831acb30dc44ab02671eca5953eadad07d6d0"}, - {file = "mypy-1.13.0-cp312-cp312-win_amd64.whl", hash = "sha256:a0affb3a79a256b4183ba09811e3577c5163ed06685e4d4b46429a271ba174d2"}, - {file = "mypy-1.13.0-cp313-cp313-macosx_10_13_x86_64.whl", hash = "sha256:a7b44178c9760ce1a43f544e595d35ed61ac2c3de306599fa59b38a6048e1aa7"}, - {file = "mypy-1.13.0-cp313-cp313-macosx_11_0_arm64.whl", hash = "sha256:5d5092efb8516d08440e36626f0153b5006d4088c1d663d88bf79625af3d1d62"}, - {file = "mypy-1.13.0-cp313-cp313-manylinux_2_17_x86_64.manylinux2014_x86_64.manylinux_2_28_x86_64.whl", hash = "sha256:de2904956dac40ced10931ac967ae63c5089bd498542194b436eb097a9f77bc8"}, - {file = "mypy-1.13.0-cp313-cp313-musllinux_1_1_x86_64.whl", hash = "sha256:7bfd8836970d33c2105562650656b6846149374dc8ed77d98424b40b09340ba7"}, - {file = "mypy-1.13.0-cp313-cp313-win_amd64.whl", hash = "sha256:9f73dba9ec77acb86457a8fc04b5239822df0c14a082564737833d2963677dbc"}, - {file = "mypy-1.13.0-cp38-cp38-macosx_10_9_x86_64.whl", hash = "sha256:100fac22ce82925f676a734af0db922ecfea991e1d7ec0ceb1e115ebe501301a"}, - {file = "mypy-1.13.0-cp38-cp38-macosx_11_0_arm64.whl", hash = "sha256:7bcb0bb7f42a978bb323a7c88f1081d1b5dee77ca86f4100735a6f541299d8fb"}, - {file = "mypy-1.13.0-cp38-cp38-manylinux_2_17_x86_64.manylinux2014_x86_64.manylinux_2_28_x86_64.whl", hash = "sha256:bde31fc887c213e223bbfc34328070996061b0833b0a4cfec53745ed61f3519b"}, - {file = "mypy-1.13.0-cp38-cp38-musllinux_1_1_x86_64.whl", hash = "sha256:07de989f89786f62b937851295ed62e51774722e5444a27cecca993fc3f9cd74"}, - {file = "mypy-1.13.0-cp38-cp38-win_amd64.whl", hash = "sha256:4bde84334fbe19bad704b3f5b78c4abd35ff1026f8ba72b29de70dda0916beb6"}, - {file = "mypy-1.13.0-cp39-cp39-macosx_10_9_x86_64.whl", hash = "sha256:0246bcb1b5de7f08f2826451abd947bf656945209b140d16ed317f65a17dc7dc"}, - {file = "mypy-1.13.0-cp39-cp39-macosx_11_0_arm64.whl", hash = "sha256:7f5b7deae912cf8b77e990b9280f170381fdfbddf61b4ef80927edd813163732"}, - {file = "mypy-1.13.0-cp39-cp39-manylinux_2_17_x86_64.manylinux2014_x86_64.manylinux_2_28_x86_64.whl", hash = "sha256:7029881ec6ffb8bc233a4fa364736789582c738217b133f1b55967115288a2bc"}, - {file = "mypy-1.13.0-cp39-cp39-musllinux_1_1_x86_64.whl", hash = "sha256:3e38b980e5681f28f033f3be86b099a247b13c491f14bb8b1e1e134d23bb599d"}, - {file = "mypy-1.13.0-cp39-cp39-win_amd64.whl", hash = "sha256:a6789be98a2017c912ae6ccb77ea553bbaf13d27605d2ca20a76dfbced631b24"}, - {file = "mypy-1.13.0-py3-none-any.whl", hash = "sha256:9c250883f9fd81d212e0952c92dbfcc96fc237f4b7c92f56ac81fd48460b3e5a"}, - {file = "mypy-1.13.0.tar.gz", hash = "sha256:0291a61b6fbf3e6673e3405cfcc0e7650bebc7939659fdca2702958038bd835e"}, + {file = "mypy-1.14.0-cp310-cp310-macosx_10_9_x86_64.whl", hash = "sha256:e971c1c667007f9f2b397ffa80fa8e1e0adccff336e5e77e74cb5f22868bee87"}, + {file = "mypy-1.14.0-cp310-cp310-macosx_11_0_arm64.whl", hash = "sha256:e86aaeaa3221a278c66d3d673b297232947d873773d61ca3ee0e28b2ff027179"}, + {file = "mypy-1.14.0-cp310-cp310-manylinux_2_17_x86_64.manylinux2014_x86_64.manylinux_2_28_x86_64.whl", hash = "sha256:1628c5c3ce823d296e41e2984ff88c5861499041cb416a8809615d0c1f41740e"}, + {file = "mypy-1.14.0-cp310-cp310-musllinux_1_2_x86_64.whl", hash = "sha256:7fadb29b77fc14a0dd81304ed73c828c3e5cde0016c7e668a86a3e0dfc9f3af3"}, + {file = "mypy-1.14.0-cp310-cp310-win_amd64.whl", hash = "sha256:3fa76988dc760da377c1e5069200a50d9eaaccf34f4ea18428a3337034ab5a44"}, + {file = "mypy-1.14.0-cp311-cp311-macosx_10_9_x86_64.whl", hash = "sha256:6e73c8a154eed31db3445fe28f63ad2d97b674b911c00191416cf7f6459fd49a"}, + {file = "mypy-1.14.0-cp311-cp311-macosx_11_0_arm64.whl", hash = "sha256:273e70fcb2e38c5405a188425aa60b984ffdcef65d6c746ea5813024b68c73dc"}, + {file = "mypy-1.14.0-cp311-cp311-manylinux_2_17_x86_64.manylinux2014_x86_64.manylinux_2_28_x86_64.whl", hash = "sha256:1daca283d732943731a6a9f20fdbcaa927f160bc51602b1d4ef880a6fb252015"}, + {file = "mypy-1.14.0-cp311-cp311-musllinux_1_2_x86_64.whl", hash = "sha256:7e68047bedb04c1c25bba9901ea46ff60d5eaac2d71b1f2161f33107e2b368eb"}, + {file = "mypy-1.14.0-cp311-cp311-win_amd64.whl", hash = "sha256:7a52f26b9c9b1664a60d87675f3bae00b5c7f2806e0c2800545a32c325920bcc"}, + {file = "mypy-1.14.0-cp312-cp312-macosx_10_13_x86_64.whl", hash = "sha256:d5326ab70a6db8e856d59ad4cb72741124950cbbf32e7b70e30166ba7bbf61dd"}, + {file = "mypy-1.14.0-cp312-cp312-macosx_11_0_arm64.whl", hash = "sha256:bf4ec4980bec1e0e24e5075f449d014011527ae0055884c7e3abc6a99cd2c7f1"}, + {file = "mypy-1.14.0-cp312-cp312-manylinux_2_17_x86_64.manylinux2014_x86_64.manylinux_2_28_x86_64.whl", hash = "sha256:390dfb898239c25289495500f12fa73aa7f24a4c6d90ccdc165762462b998d63"}, + {file = "mypy-1.14.0-cp312-cp312-musllinux_1_2_x86_64.whl", hash = "sha256:7e026d55ddcd76e29e87865c08cbe2d0104e2b3153a523c529de584759379d3d"}, + {file = "mypy-1.14.0-cp312-cp312-win_amd64.whl", hash = "sha256:585ed36031d0b3ee362e5107ef449a8b5dfd4e9c90ccbe36414ee405ee6b32ba"}, + {file = "mypy-1.14.0-cp313-cp313-macosx_10_13_x86_64.whl", hash = "sha256:e9f6f4c0b27401d14c483c622bc5105eff3911634d576bbdf6695b9a7c1ba741"}, + {file = "mypy-1.14.0-cp313-cp313-macosx_11_0_arm64.whl", hash = "sha256:56b2280cedcb312c7a79f5001ae5325582d0d339bce684e4a529069d0e7ca1e7"}, + {file = "mypy-1.14.0-cp313-cp313-manylinux_2_17_x86_64.manylinux2014_x86_64.manylinux_2_28_x86_64.whl", hash = "sha256:342de51c48bab326bfc77ce056ba08c076d82ce4f5a86621f972ed39970f94d8"}, + {file = "mypy-1.14.0-cp313-cp313-musllinux_1_2_x86_64.whl", hash = "sha256:00df23b42e533e02a6f0055e54de9a6ed491cd8b7ea738647364fd3a39ea7efc"}, + {file = "mypy-1.14.0-cp313-cp313-win_amd64.whl", hash = "sha256:e8c8387e5d9dff80e7daf961df357c80e694e942d9755f3ad77d69b0957b8e3f"}, + {file = "mypy-1.14.0-cp38-cp38-macosx_10_9_x86_64.whl", hash = "sha256:0b16738b1d80ec4334654e89e798eb705ac0c36c8a5c4798496cd3623aa02286"}, + {file = "mypy-1.14.0-cp38-cp38-macosx_11_0_arm64.whl", hash = "sha256:10065fcebb7c66df04b05fc799a854b1ae24d9963c8bb27e9064a9bdb43aa8ad"}, + {file = "mypy-1.14.0-cp38-cp38-manylinux_2_17_x86_64.manylinux2014_x86_64.manylinux_2_28_x86_64.whl", hash = "sha256:fbb7d683fa6bdecaa106e8368aa973ecc0ddb79a9eaeb4b821591ecd07e9e03c"}, + {file = "mypy-1.14.0-cp38-cp38-musllinux_1_2_x86_64.whl", hash = "sha256:3498cb55448dc5533e438cd13d6ddd28654559c8c4d1fd4b5ca57a31b81bac01"}, + {file = "mypy-1.14.0-cp38-cp38-win_amd64.whl", hash = "sha256:c7b243408ea43755f3a21a0a08e5c5ae30eddb4c58a80f415ca6b118816e60aa"}, + {file = "mypy-1.14.0-cp39-cp39-macosx_10_9_x86_64.whl", hash = "sha256:14117b9da3305b39860d0aa34b8f1ff74d209a368829a584eb77524389a9c13e"}, + {file = "mypy-1.14.0-cp39-cp39-macosx_11_0_arm64.whl", hash = "sha256:af98c5a958f9c37404bd4eef2f920b94874507e146ed6ee559f185b8809c44cc"}, + {file = "mypy-1.14.0-cp39-cp39-manylinux_2_17_x86_64.manylinux2014_x86_64.manylinux_2_28_x86_64.whl", hash = "sha256:f0b343a1d3989547024377c2ba0dca9c74a2428ad6ed24283c213af8dbb0710b"}, + {file = "mypy-1.14.0-cp39-cp39-musllinux_1_2_x86_64.whl", hash = "sha256:cdb5563c1726c85fb201be383168f8c866032db95e1095600806625b3a648cb7"}, + {file = "mypy-1.14.0-cp39-cp39-win_amd64.whl", hash = "sha256:74e925649c1ee0a79aa7448baf2668d81cc287dc5782cff6a04ee93f40fb8d3f"}, + {file = "mypy-1.14.0-py3-none-any.whl", hash = "sha256:2238d7f93fc4027ed1efc944507683df3ba406445a2b6c96e79666a045aadfab"}, + {file = "mypy-1.14.0.tar.gz", hash = "sha256:822dbd184d4a9804df5a7d5335a68cf7662930e70b8c1bc976645d1509f9a9d6"}, ] [package.dependencies] -mypy-extensions = ">=1.0.0" +mypy_extensions = ">=1.0.0" tomli = {version = ">=1.1.0", markers = "python_version < \"3.11\""} -typing-extensions = ">=4.6.0" +typing_extensions = ">=4.6.0" [package.extras] dmypy = ["psutil (>=4.0)"] @@ -984,13 +971,13 @@ windows-terminal = ["colorama (>=0.4.6)"] [[package]] name = "pymdown-extensions" -version = "10.12" +version = "10.13" description = "Extension pack for Python Markdown." optional = false python-versions = ">=3.8" files = [ - {file = "pymdown_extensions-10.12-py3-none-any.whl", hash = "sha256:49f81412242d3527b8b4967b990df395c89563043bc51a3d2d7d500e52123b77"}, - {file = "pymdown_extensions-10.12.tar.gz", hash = "sha256:b0ee1e0b2bef1071a47891ab17003bfe5bf824a398e13f49f8ed653b699369a7"}, + {file = "pymdown_extensions-10.13-py3-none-any.whl", hash = "sha256:80bc33d715eec68e683e04298946d47d78c7739e79d808203df278ee8ef89428"}, + {file = "pymdown_extensions-10.13.tar.gz", hash = "sha256:e0b351494dc0d8d14a1f52b39b1499a00ef1566b4ba23dc74f1eba75c736f5dd"}, ] [package.dependencies] @@ -1453,13 +1440,13 @@ files = [ [[package]] name = "urllib3" -version = "2.2.3" +version = "2.3.0" description = "HTTP library with thread-safe connection pooling, file post, and more." optional = false -python-versions = ">=3.8" +python-versions = ">=3.9" files = [ - {file = "urllib3-2.2.3-py3-none-any.whl", hash = "sha256:ca899ca043dcb1bafa3e262d73aa25c465bfb49e0bd9dd5d59f1d0acba2f8fac"}, - {file = "urllib3-2.2.3.tar.gz", hash = "sha256:e7d814a81dad81e6caf2ec9fdedb284ecc9c73076b62654547cc64ccdcae26e9"}, + {file = "urllib3-2.3.0-py3-none-any.whl", hash = "sha256:1cee9ad369867bfdbbb48b7dd50374c0967a0bb7710050facf0dd6911440e3df"}, + {file = "urllib3-2.3.0.tar.gz", hash = "sha256:f8c5449b3cf0861679ce7e0503c7b44b5ec981bec0d1d3795a07f1ba96f0204d"}, ] [package.extras] @@ -1546,4 +1533,4 @@ type = ["pytest-mypy"] [metadata] lock-version = "2.0" python-versions = ">=3.9.0,<4.0" -content-hash = "364b54955016dd69c74464ad0715420e8626565bdffab45fb0d1315fa4846966" +content-hash = "76bc8d4465a4f69d24221f09eb548ed48b0e7cbd8e8d41e7132b9147dfdad54a" diff --git a/pyproject.toml b/pyproject.toml index 6357a3af..801f94b7 100644 --- a/pyproject.toml +++ b/pyproject.toml @@ -26,7 +26,7 @@ include = ["LICENSE"] python = ">=3.9.0,<4.0" attrs = ">=19.3.0" pysam = ">=0.22.1" -typing_extensions = { version = ">=3.7.4", python = "<3.12" } +typing_extensions = { version = ">=4.12.2", python = "<3.12" } numpy = [ {version = "^1.26.4", python = ">=3.12"}, {version = "^1.25.2", python = ">=3.9,<3.12"}, diff --git a/tests/fgpyo/sam/test_builder.py b/tests/fgpyo/sam/test_builder.py index f3bbcd53..2b5d7959 100755 --- a/tests/fgpyo/sam/test_builder.py +++ b/tests/fgpyo/sam/test_builder.py @@ -114,33 +114,56 @@ def test_unmapped_reads() -> None: assert r1.mate_is_unmapped assert r2.is_unmapped assert not r2.mate_is_unmapped - for rec in r1, r2: - assert rec.reference_name == "chr1" - assert rec.reference_start == 1000 - assert rec.next_reference_name == "chr1" - assert rec.next_reference_start == 1000 + assert r1.reference_name == "chr1" + assert r1.reference_start == 1000 + assert r1.next_reference_name is None + assert r1.next_reference_start == sam.NO_REF_POS + assert r2.reference_name is None + assert r2.reference_start == sam.NO_REF_POS + assert r2.next_reference_name == "chr1" + assert r2.next_reference_start == 1000 r1, r2 = builder.add_pair(chrom="chr1", start2=2000) assert r1.is_unmapped assert not r1.mate_is_unmapped assert not r2.is_unmapped assert r2.mate_is_unmapped - for rec in r1, r2: - assert rec.reference_name == "chr1" - assert rec.reference_start == 2000 - assert rec.next_reference_name == "chr1" - assert rec.next_reference_start == 2000 + assert r1.reference_name is None + assert r1.reference_start == sam.NO_REF_POS + assert r1.next_reference_name == "chr1" + assert r1.next_reference_start == 2000 + assert r2.reference_name == "chr1" + assert r2.reference_start == 2000 + assert r2.next_reference_name is None + assert r2.next_reference_start == sam.NO_REF_POS r1, r2 = builder.add_pair(chrom=sam.NO_REF_NAME) assert r1.is_unmapped assert r1.mate_is_unmapped assert r2.is_unmapped assert r2.mate_is_unmapped - for rec in r1, r2: - assert rec.reference_name is None - assert rec.reference_start == sam.NO_REF_POS - assert rec.next_reference_name is None - assert rec.next_reference_start == sam.NO_REF_POS + assert r1.reference_name is None + assert r1.reference_start == sam.NO_REF_POS + assert r1.next_reference_name is None + assert r1.next_reference_start == sam.NO_REF_POS + assert r2.reference_name is None + assert r2.reference_start == sam.NO_REF_POS + assert r2.next_reference_name is None + assert r2.next_reference_start == sam.NO_REF_POS + + r1, r2 = builder.add_pair(chrom=None) + assert r1.is_unmapped + assert r1.mate_is_unmapped + assert r2.is_unmapped + assert r2.mate_is_unmapped + assert r1.reference_name is None + assert r1.reference_start == sam.NO_REF_POS + assert r1.next_reference_name is None + assert r1.next_reference_start == sam.NO_REF_POS + assert r2.reference_name is None + assert r2.reference_start == sam.NO_REF_POS + assert r2.next_reference_name is None + assert r2.next_reference_start == sam.NO_REF_POS def test_invalid_strand() -> None: diff --git a/tests/fgpyo/sam/test_sam.py b/tests/fgpyo/sam/test_sam.py index 5ac6639b..6c1daaf7 100755 --- a/tests/fgpyo/sam/test_sam.py +++ b/tests/fgpyo/sam/test_sam.py @@ -20,6 +20,7 @@ from fgpyo.sam import PairOrientation from fgpyo.sam import SamFileType from fgpyo.sam import is_proper_pair +from fgpyo.sam import sum_of_base_qualities from fgpyo.sam.builder import SamBuilder @@ -311,19 +312,19 @@ def test_pair_orientation_build_with_r2() -> None: r1, r2 = builder.add_pair(chrom="chr1", start1=100, cigar1="115M", start2=250, cigar2="40M") r1.is_forward = False r2.is_forward = True - sam.set_pair_info(r1, r2) + sam.set_mate_info(r1, r2) assert PairOrientation.build(r1, r2) is PairOrientation.RF r1, r2 = builder.add_pair(chrom="chr1", start1=100, cigar1="115M", start2=250, cigar2="40M") r1.is_forward = True r2.is_forward = True - sam.set_pair_info(r1, r2) + sam.set_mate_info(r1, r2) assert PairOrientation.build(r1, r2) is PairOrientation.TANDEM r1, r2 = builder.add_pair(chrom="chr1", start1=100, cigar1="115M", start2=250, cigar2="40M") r1.is_forward = False r2.is_forward = False - sam.set_pair_info(r1, r2) + sam.set_mate_info(r1, r2) assert PairOrientation.build(r1, r2) is PairOrientation.TANDEM @@ -337,7 +338,7 @@ def test_pair_orientation_is_fr_if_opposite_directions_and_overlapping() -> None r1, r2 = builder.add_pair(chrom="chr1", start1=100, cigar1="10M", start2=100, cigar2="10M") r1.is_reverse = True r2.is_reverse = False - sam.set_pair_info(r1, r2) + sam.set_mate_info(r1, r2) assert PairOrientation.build(r1, r2) is PairOrientation.FR @@ -369,19 +370,19 @@ def test_pair_orientation_build_with_no_r2_but_r2_mapped() -> None: r1, r2 = builder.add_pair(chrom="chr1", start1=100, cigar1="115M", start2=250, cigar2="40M") r1.is_forward = False r2.is_forward = True - sam.set_pair_info(r1, r2) + sam.set_mate_info(r1, r2) assert PairOrientation.build(r1) is PairOrientation.RF r1, r2 = builder.add_pair(chrom="chr1", start1=100, cigar1="115M", start2=250, cigar2="40M") r1.is_forward = True r2.is_forward = True - sam.set_pair_info(r1, r2) + sam.set_mate_info(r1, r2) assert PairOrientation.build(r1) is PairOrientation.TANDEM r1, r2 = builder.add_pair(chrom="chr1", start1=100, cigar1="115M", start2=250, cigar2="40M") r1.is_forward = False r2.is_forward = False - sam.set_pair_info(r1, r2) + sam.set_mate_info(r1, r2) assert PairOrientation.build(r1) is PairOrientation.TANDEM @@ -391,27 +392,23 @@ def test_pair_orientation_build_with_either_unmapped_but_no_r2() -> None: r1, r2 = builder.add_pair() assert r1.is_unmapped assert r2.is_unmapped - sam.set_pair_info(r1, r2) assert PairOrientation.build(r1) is None r1, r2 = builder.add_pair(chrom="chr1", start1=100) assert r1.is_mapped assert r2.is_unmapped - sam.set_pair_info(r1, r2) assert PairOrientation.build(r1) is None r1, r2 = builder.add_pair(chrom="chr1", start2=100) assert r1.is_unmapped assert r2.is_mapped - sam.set_pair_info(r1, r2) assert PairOrientation.build(r1) is None def test_pair_orientation_build_raises_if_it_cant_find_mate_cigar_tag() -> None: """Test that an exception is raised if we cannot find the mate cigar tag.""" builder = SamBuilder() - r1, r2 = builder.add_pair(chrom="chr1", start1=10, start2=30) - sam.set_pair_info(r1, r2) + r1, _ = builder.add_pair(chrom="chr1", start1=10, start2=30) r1.set_tag("MC", None) # Clear out the MC tag. with pytest.raises(ValueError): @@ -427,7 +424,7 @@ def test_is_proper_pair_when_actually_proper() -> None: r1, r2 = builder.add_pair(chrom="chr1", start1=100, cigar1="10M", start2=100, cigar2="10M") r1.is_reverse = True r2.is_reverse = False - sam.set_pair_info(r1, r2) + sam.set_mate_info(r1, r2) assert is_proper_pair(r1, r2) @@ -440,7 +437,7 @@ def test_is_proper_pair_when_actually_proper_and_no_r2() -> None: r1, r2 = builder.add_pair(chrom="chr1", start1=100, cigar1="10M", start2=100, cigar2="10M") r1.is_reverse = True r2.is_reverse = False - sam.set_pair_info(r1, r2) + sam.set_mate_info(r1, r2) assert is_proper_pair(r1) @@ -450,19 +447,19 @@ def test_not_is_proper_pair_if_wrong_orientation() -> None: r1, r2 = builder.add_pair(chrom="chr1", start1=100, cigar1="115M", start2=250, cigar2="40M") r1.is_forward = False r2.is_forward = True - sam.set_pair_info(r1, r2) + sam.set_mate_info(r1, r2) assert not is_proper_pair(r1, r2) r1, r2 = builder.add_pair(chrom="chr1", start1=100, cigar1="115M", start2=250, cigar2="40M") r1.is_forward = True r2.is_forward = True - sam.set_pair_info(r1, r2) + sam.set_mate_info(r1, r2) assert not is_proper_pair(r1, r2) r1, r2 = builder.add_pair(chrom="chr1", start1=100, cigar1="115M", start2=250, cigar2="40M") r1.is_forward = False r2.is_forward = False - sam.set_pair_info(r1, r2) + sam.set_mate_info(r1, r2) assert not is_proper_pair(r1, r2) @@ -472,19 +469,19 @@ def test_not_is_proper_pair_if_wrong_orientation_and_no_r2() -> None: r1, r2 = builder.add_pair(chrom="chr1", start1=100, cigar1="115M", start2=250, cigar2="40M") r1.is_forward = False r2.is_forward = True - sam.set_pair_info(r1, r2) + sam.set_mate_info(r1, r2) assert not is_proper_pair(r1) r1, r2 = builder.add_pair(chrom="chr1", start1=100, cigar1="115M", start2=250, cigar2="40M") r1.is_forward = True r2.is_forward = True - sam.set_pair_info(r1, r2) + sam.set_mate_info(r1, r2) assert not is_proper_pair(r1) r1, r2 = builder.add_pair(chrom="chr1", start1=100, cigar1="115M", start2=250, cigar2="40M") r1.is_forward = False r2.is_forward = False - sam.set_pair_info(r1, r2) + sam.set_mate_info(r1, r2) assert not is_proper_pair(r1) @@ -492,7 +489,6 @@ def test_not_is_proper_pair_if_too_far_apart() -> None: """Test that reads are not properly paired if they are too far apart.""" builder = SamBuilder() r1, r2 = builder.add_pair(chrom="chr1", start1=100, start2=100 + 1000) - sam.set_pair_info(r1, r2) assert not is_proper_pair(r1, r2) @@ -506,6 +502,18 @@ def test_isize() -> None: assert sam.isize(r1, r2) == 0 +def test_sum_of_base_qualities() -> None: + builder = SamBuilder(r1_len=5, r2_len=5) + single = builder.add_single(quals=[1, 2, 3, 4, 5]) + assert sum_of_base_qualities(single, min_quality_score=0) == 15 + + +def test_sum_of_base_qualities_some_below_minimum() -> None: + builder = SamBuilder(r1_len=5, r2_len=5) + single = builder.add_single(quals=[1, 2, 3, 4, 5]) + assert sum_of_base_qualities(single, min_quality_score=4) == 9 + + def test_calc_edit_info_no_edits() -> None: chrom = "ACGCTAGACTGCTAGCAGCATCTCATAGCACTTCGCGCTATAGCGATATAAATATCGCGATCTAGCG" builder = SamBuilder(r1_len=30) From 56722b066a0e59457bca36b8ea833edbcdf8dcfb Mon Sep 17 00:00:00 2001 From: clintval Date: Thu, 26 Dec 2024 20:44:44 -0500 Subject: [PATCH 08/36] chore: fix copy-paste formatting issue --- fgpyo/sam/__init__.py | 3 +++ 1 file changed, 3 insertions(+) diff --git a/fgpyo/sam/__init__.py b/fgpyo/sam/__init__.py index 51e02cbd..f77b4428 100644 --- a/fgpyo/sam/__init__.py +++ b/fgpyo/sam/__init__.py @@ -806,10 +806,13 @@ def isize(r1: AlignedSegment, r2: AlignedSegment) -> int: def sum_of_base_qualities(rec: AlignedSegment, min_quality_score: int = 15) -> int: """Calculate the sum of base qualities score for an alignment record. + This function is useful for calculating the "mate score" as implemented in samtools fixmate. + Args: rec: The alignment record to calculate the sum of base qualities from. min_quality_score: The minimum base quality score to use for summation. + See: [`calc_sum_of_base_qualities()`](https://github.com/samtools/samtools/blob/4f3a7397a1f841020074c0048c503a01a52d5fa2/bam_mate.c#L227-L238) [`MD_MIN_QUALITY`](https://github.com/samtools/samtools/blob/4f3a7397a1f841020074c0048c503a01a52d5fa2/bam_mate.c#L42) From c74834bd8a55840c2f0c2c8720866605e5300dac Mon Sep 17 00:00:00 2001 From: clintval Date: Thu, 26 Dec 2024 20:40:07 -0500 Subject: [PATCH 09/36] Allow insert size calculation to work on 1 read only --- fgpyo/sam/__init__.py | 45 ++++++++++++++++++++++++++----------- tests/fgpyo/sam/test_sam.py | 45 ++++++++++++++++++++++++++++++++++++- 2 files changed, 76 insertions(+), 14 deletions(-) diff --git a/fgpyo/sam/__init__.py b/fgpyo/sam/__init__.py index f77b4428..698b1ea5 100644 --- a/fgpyo/sam/__init__.py +++ b/fgpyo/sam/__init__.py @@ -668,6 +668,35 @@ def build( return PairOrientation.RF +def isize(r1: AlignedSegment, r2: Optional[AlignedSegment] = None) -> int: + """Computes the insert size for a pair of records.""" + if r2 is None: + r2_is_unmapped = r1.mate_is_unmapped + r2_reference_id = r1.next_reference_id + else: + r2_is_unmapped = r2.is_unmapped + r2_reference_id = r2.reference_id + + if r1.is_unmapped or r2_is_unmapped or r1.reference_id != r2_reference_id: + return 0 + + if r2 is None: + if not r1.has_tag("MC"): + raise ValueError('Cannot determine proper pair status without R2\'s cigar ("MC")!') + r2_cigar = Cigar.from_cigarstring(str(r1.get_tag("MC"))) + r2_is_reverse = r1.mate_is_reverse + r2_reference_start = r1.next_reference_start + r2_reference_end = r1.next_reference_start + r2_cigar.length_on_target() + else: + r2_is_reverse = r2.is_reverse + r2_reference_start = r2.reference_start + r2_reference_end = r2.reference_end + + r1_pos = r1.reference_end if r1.is_reverse else r1.reference_start + r2_pos = r2_reference_end if r2_is_reverse else r2_reference_start + return r2_pos - r1_pos + + DefaultProperlyPairedOrientations = {PairOrientation.FR} """The default orientations for properly paired reads.""" @@ -677,6 +706,7 @@ def is_proper_pair( r2: Optional[AlignedSegment] = None, max_insert_size: int = 1000, orientations: set[PairOrientation] = DefaultProperlyPairedOrientations, + isize: Callable[[AlignedSegment, AlignedSegment], int] = isize, ) -> bool: """Determines if a read pair is properly paired or not. @@ -691,6 +721,7 @@ def is_proper_pair( r2: The second read in the template. If undefined, mate data set upon R1 will be used. max_insert_size: The maximum insert size to consider a read pair "proper". orientations: The valid set of orientations to consider a read pair "proper". + isize: A function that takes the two alignments and calculates their isize. See: [`htsjdk.samtools.SamPairUtil.isProperPair()`](https://github.com/samtools/htsjdk/blob/c31bc92c24bc4e9552b2a913e52286edf8f8ab96/src/main/java/htsjdk/samtools/SamPairUtil.java#L106-L125) @@ -707,9 +738,7 @@ def is_proper_pair( and r2_is_mapped and r1.reference_id == r2_reference_id and PairOrientation.build(r1, r2) in orientations - # TODO: consider replacing with `abs(isize(r1, r2)) <= max_insert_size` - # which can only be done if isize() is modified to allow for an optional R2. - and 0 < abs(r1.template_length) <= max_insert_size + and 0 < abs(isize(r1, r2)) <= max_insert_size ) @@ -794,16 +823,6 @@ def from_read(cls, read: pysam.AlignedSegment) -> List["SupplementaryAlignment"] return [] -def isize(r1: AlignedSegment, r2: AlignedSegment) -> int: - """Computes the insert size for a pair of records.""" - if r1.is_unmapped or r2.is_unmapped or r1.reference_id != r2.reference_id: - return 0 - else: - r1_pos = r1.reference_end if r1.is_reverse else r1.reference_start - r2_pos = r2.reference_end if r2.is_reverse else r2.reference_start - return r2_pos - r1_pos - - def sum_of_base_qualities(rec: AlignedSegment, min_quality_score: int = 15) -> int: """Calculate the sum of base qualities score for an alignment record. diff --git a/tests/fgpyo/sam/test_sam.py b/tests/fgpyo/sam/test_sam.py index 6c1daaf7..cb60ab5c 100755 --- a/tests/fgpyo/sam/test_sam.py +++ b/tests/fgpyo/sam/test_sam.py @@ -492,7 +492,16 @@ def test_not_is_proper_pair_if_too_far_apart() -> None: assert not is_proper_pair(r1, r2) -def test_isize() -> None: +def test_is_not_proper_pair_with_custom_isize_func() -> None: + """Test that reads are not properly paired because of a custom isize function.""" + builder = SamBuilder() + r1, r2 = builder.add_pair(chrom="chr1", start1=100, start2=100) + assert is_proper_pair(r1, r2) + assert not is_proper_pair(r1, r2, isize=lambda a, b: False) + + +def test_isize_when_r2_defined() -> None: + """Tests that an insert size can be calculated when both input records are defined.""" builder = SamBuilder() r1, r2 = builder.add_pair(chrom="chr1", start1=100, cigar1="115M", start2=250, cigar2="40M") assert sam.isize(r1, r2) == 190 @@ -502,6 +511,40 @@ def test_isize() -> None: assert sam.isize(r1, r2) == 0 +def test_isize_when_r2_undefined() -> None: + """Tests that an insert size can be calculated when R1 is provided only.""" + builder = SamBuilder() + r1, r2 = builder.add_pair(chrom="chr1", start1=100, cigar1="115M", start2=250, cigar2="40M") + assert sam.isize(r1) == 190 + assert sam.isize(r2) == -190 + + r1, r2 = builder.add_pair(chrom="chr1", start1=100, cigar1="115M") + assert sam.isize(r1) == 0 + assert sam.isize(r2) == 0 + + +def test_isize_when_r2_undefined_indels_in_r2_cigar() -> None: + """Tests that an insert size can be derived without R2 by using R2's cigar.""" + builder = SamBuilder() + r1, _ = builder.add_pair( + chrom="chr1", + start1=100, + cigar1="115M", + start2=250, + cigar2="10S5M1D1M1D2I2D30M", # only 40bp reference-consuming operators + ) + assert sam.isize(r1) == 190 + + +def test_isize_raises_when_r2_not_provided_and_no_mate_cigar_tag() -> None: + """Tests that an insert size can be calculated when both input records are defined.""" + builder = SamBuilder() + r1, _ = builder.add_pair(chrom="chr1", start1=100, cigar1="115M", start2=250, cigar2="40M") + r1.set_tag("MC", None) + with pytest.raises(ValueError, match="Cannot determine proper pair status without R2's cigar"): + sam.isize(r1) + + def test_sum_of_base_qualities() -> None: builder = SamBuilder(r1_len=5, r2_len=5) single = builder.add_single(quals=[1, 2, 3, 4, 5]) From 8c69815f2ceb0d25307bfdad948bd2abd8457723 Mon Sep 17 00:00:00 2001 From: clintval Date: Thu, 26 Dec 2024 19:38:49 -0500 Subject: [PATCH 10/36] Add methods to fix mate info on non-primaries and templates --- fgpyo/sam/__init__.py | 101 ++++++++++++++++++++++++++++++++++++++++++ 1 file changed, 101 insertions(+) diff --git a/fgpyo/sam/__init__.py b/fgpyo/sam/__init__.py index 698b1ea5..b0600a0d 100644 --- a/fgpyo/sam/__init__.py +++ b/fgpyo/sam/__init__.py @@ -876,6 +876,78 @@ def set_mate_info( r2.is_proper_pair = proper_pair +def set_mate_info_on_secondary( + primary: AlignedSegment, + secondary: AlignedSegment, + is_proper_pair: Callable[[AlignedSegment, AlignedSegment], bool] = is_proper_pair, +) -> None: + """Set mate info on a secondary alignment to the next read ordinal's primary alignment. + + Args: + primary: The primary alignment of the secondary's mate. + secondary: The secondary alignment to set mate information upon. + is_proper_pair: A function that takes the two alignments and determines proper pair status. + + Raises: + ValueError: If primary and secondary are of the same read ordinal. + ValueError: If the primary is marked as either secondary or supplementary. + ValueError: If the secondary is not marked as secondary. + """ + if primary.is_read1 == secondary.is_read1 or primary.is_secondary or primary.is_supplementary: + raise ValueError("Secondary mate info must be set from a primary of the next ordinal!") + if not secondary.is_secondary: + raise ValueError("Cannot set mate info on an alignment not marked as secondary!") + if primary.query_name != secondary.query_name: + raise ValueError("Cannot set mate info on alignments with different query names!") + + secondary.next_reference_id = primary.reference_id + secondary.next_reference_name = primary.reference_name + secondary.next_reference_start = primary.reference_start + secondary.mate_is_forward = primary.is_forward + secondary.mate_is_mapped = primary.is_mapped + secondary.set_tag("MC", primary.cigarstring) + secondary.set_tag("MQ", primary.mapping_quality) + secondary.set_tag("ms", sum_of_base_qualities(primary)) + + # NB: calculate isize and proper pair as if this secondary alignment was the primary alignment. + secondary.is_proper_pair = is_proper_pair(primary, secondary) + secondary.template_length = isize(primary, secondary) + + +def set_mate_info_on_supplementary(primary: AlignedSegment, supp: AlignedSegment) -> None: + """Set mate info on a supplementary alignment to the next read ordinal's primary alignment. + + Args: + primary: The primary alignment of the supplementary's mate. + supp: The supplementary alignment to set mate information upon. + + Raises: + ValueError: If primary and secondary are of the same read ordinal. + ValueError: If the primary is marked as either secondary or supplementary. + ValueError: If the secondary is not marked as secondary. + """ + if primary.is_read1 == supp.is_read1 or primary.is_secondary or primary.is_supplementary: + raise ValueError("Supplementary mate info must be set from a primary of the next ordinal!") + if not supp.is_supplementary: + raise ValueError("Cannot set mate info on an alignment not marked as supplementary!") + if primary.query_name != supp.query_name: + raise ValueError("Cannot set mate info on alignments with different query names!") + + supp.next_reference_id = primary.reference_id + supp.next_reference_name = primary.reference_name + supp.next_reference_start = primary.reference_start + supp.mate_is_forward = primary.is_forward + supp.mate_is_mapped = primary.is_mapped + supp.set_tag("MC", primary.cigarstring) + supp.set_tag("MQ", primary.mapping_quality) + supp.set_tag("ms", sum_of_base_qualities(primary)) + + # NB: for a non-secondary supplemental alignment, set the following to the same as the primary. + if not supp.is_secondary: + supp.is_proper_pair = primary.is_proper_pair + supp.template_length = -primary.template_length + + def set_as_pairs( r1: AlignedSegment, r2: AlignedSegment, @@ -1157,6 +1229,10 @@ def all_recs(self) -> Iterator[AlignedSegment]: for rec in recs: yield rec + def set_mate_info(self) -> "Template": + """Reset all mate information on every record in a template.""" + return set_mate_info_for_template(self) + def write_to( self, writer: SamFile, @@ -1215,6 +1291,31 @@ def __next__(self) -> Template: return Template.build(recs, validate=False) +def set_mate_info_for_template( + template: Template, + is_proper_pair: Callable[[AlignedSegment, AlignedSegment], bool] = is_proper_pair, +) -> Template: + """Reset all mate information on every record in a template. + + Args: + template: The template of alignments to reset all mate information on. + is_proper_pair: A function that takes two alignments and determines proper pair status. + """ + if template.r1 is not None and template.r2 is not None: + set_mate_info(template.r1, template.r2, is_proper_pair=is_proper_pair) + if template.r1 is not None: + for rec in template.r2_secondaries: + set_mate_info_on_secondary(template.r1, rec, is_proper_pair=is_proper_pair) + for rec in template.r2_supplementals: + set_mate_info_on_supplementary(template.r1, rec) + if template.r2 is not None: + for rec in template.r1_secondaries: + set_mate_info_on_secondary(template.r2, rec, is_proper_pair=is_proper_pair) + for rec in template.r1_supplementals: + set_mate_info_on_supplementary(template.r2, rec) + return template + + class SamOrder(enum.Enum): """ Enumerations of possible sort orders for a SAM file. From 386d058ac8fbef8af5ef60728aeba88c753c85c2 Mon Sep 17 00:00:00 2001 From: clintval Date: Fri, 27 Dec 2024 11:02:03 -0500 Subject: [PATCH 11/36] chore: remove set_as_pairs, unit tests for set_mate_info --- fgpyo/sam/__init__.py | 34 ++-------- tests/fgpyo/sam/test_sam.py | 124 ++++++++++++++++++++++++++++++++++++ 2 files changed, 130 insertions(+), 28 deletions(-) diff --git a/fgpyo/sam/__init__.py b/fgpyo/sam/__init__.py index f77b4428..d9ad5b49 100644 --- a/fgpyo/sam/__init__.py +++ b/fgpyo/sam/__init__.py @@ -857,23 +857,17 @@ def set_mate_info( r2.is_proper_pair = proper_pair -def set_as_pairs( - r1: AlignedSegment, - r2: AlignedSegment, - is_proper_pair: Callable[[AlignedSegment, AlignedSegment], bool] = is_proper_pair, -) -> None: - """Forces the two reads to become pairs as long as they share the same query name. - - This function will take two reads, as long as they have the same query name, and make them - pairs. The reads are marked as pairs and then first and second read flags are set. Finally, all - mate information is reset upon both reads. +@deprecated("Use `set_mate_info()` instead. Deprecated as of fgpyo 0.8.0.") +def set_pair_info(r1: AlignedSegment, r2: AlignedSegment, proper_pair: bool = True) -> None: + """Resets mate pair information between reads in a pair. - This function is useful for taking once-single-end reads and making them pairs. + Requires that both r1 and r2 are mapped. Can be handed reads that already have pairing flags + setup or independent R1 and R2 records that are currently flagged as SE reads. Args: r1: Read 1 (first read in the template). r2: Read 2 with the same query name as r1 (second read in the template). - is_proper_pair: A function that takes the two reads and determines proper pair status. + proper_pair: whether the pair is proper or not. """ if r1.query_name != r2.query_name: raise ValueError("Cannot pair reads with different query names!") @@ -885,25 +879,9 @@ def set_as_pairs( r1.is_read2 = False r2.is_read2 = True r2.is_read1 = False - set_mate_info(r1=r1, r2=r2, is_proper_pair=is_proper_pair) -@deprecated("Use `set_mate_info()` instead. Deprecated as of fgpyo 0.8.0.") -def set_pair_info(r1: AlignedSegment, r2: AlignedSegment, proper_pair: bool = True) -> None: - """Resets mate pair information between reads in a pair. - - Requires that both r1 and r2 are mapped. Can be handed reads that already have pairing flags - setup or independent R1 and R2 records that are currently flagged as SE reads. - - Args: - r1: Read 1 (first read in the template). - r2: Read 2 with the same query name as r1 (second read in the template). - proper_pair: whether the pair is proper or not. - """ - set_as_pairs(r1, r2, lambda r1, r2: proper_pair) - - @attr.s(frozen=True, auto_attribs=True) class ReadEditInfo: """ diff --git a/tests/fgpyo/sam/test_sam.py b/tests/fgpyo/sam/test_sam.py index 6c1daaf7..af6fcf54 100755 --- a/tests/fgpyo/sam/test_sam.py +++ b/tests/fgpyo/sam/test_sam.py @@ -20,6 +20,7 @@ from fgpyo.sam import PairOrientation from fgpyo.sam import SamFileType from fgpyo.sam import is_proper_pair +from fgpyo.sam import set_mate_info from fgpyo.sam import sum_of_base_qualities from fgpyo.sam.builder import SamBuilder @@ -579,3 +580,126 @@ def test_calc_edit_info_with_aligned_Ns() -> None: assert info.deletions == 0 assert info.deleted_bases == 0 assert info.nm == 5 + + +def test_set_mate_info_raises_mimatched_query_names() -> None: + """Test set_mate_info raises an exception for mismatched query names.""" + builder = SamBuilder() + r1 = builder.add_single(read_num=1) + r2 = builder.add_single(read_num=2) + assert r1.query_name != r2.query_name + with pytest.raises( + ValueError, match="Cannot set mate info on alignments with different query names!" + ): + set_mate_info(r1, r2) + + +def test_set_mate_info_both_unmapped() -> None: + """Test set_mate_info sets mate info for two unmapped records.""" + builder = SamBuilder() + r1, r2 = builder.add_pair() + assert r1.is_unmapped is True + assert r2.is_unmapped is True + + set_mate_info(r1, r2) + + for rec in (r1, r2): + assert rec.reference_id == sam.NO_REF_INDEX + assert rec.reference_name is None + assert rec.reference_start == sam.NO_REF_POS + assert rec.next_reference_id == sam.NO_REF_INDEX + assert rec.next_reference_name is None + assert rec.next_reference_start == sam.NO_REF_POS + assert not rec.has_tag("MC") + assert rec.has_tag("MQ") + assert rec.get_tag("MQ") == 0 + assert rec.has_tag("ms") + assert rec.get_tag("ms") == 3000 + assert rec.template_length == 0 + assert rec.is_proper_pair is False + + # NB: unmapped records are forward until proven otherwise + assert r1.is_forward is True + assert r2.is_forward is True + assert r1.mate_is_forward is True + assert r2.mate_is_forward is True + + +def test_set_mate_info_one_unmapped() -> None: + """Test set_mate_info sets mate info for one mapped and one unmapped records.""" + builder = SamBuilder() + r1_mapped, r2_unmapped = builder.add_pair(chrom="chr1", start1=200, strand1="-") + r1_unmapped, r2_mapped = builder.add_pair(chrom="chr1", start2=200, strand2="-") + + for mapped, unmapped in [(r1_mapped, r2_unmapped), (r2_mapped, r1_unmapped)]: + assert mapped.is_mapped is True + assert unmapped.is_unmapped is True + + set_mate_info(mapped, unmapped) + + assert mapped.reference_id == mapped.header.get_tid("chr1") + assert mapped.reference_name == "chr1" + assert mapped.reference_start == 200 + assert mapped.next_reference_id == sam.NO_REF_INDEX + assert mapped.next_reference_name is None + assert mapped.next_reference_start == sam.NO_REF_POS + assert not mapped.has_tag("MC") + assert mapped.has_tag("MQ") + assert mapped.get_tag("MQ") == 0 + assert mapped.has_tag("ms") + assert mapped.get_tag("ms") == 3000 + assert mapped.template_length == 0 + assert mapped.is_forward is False + assert mapped.is_proper_pair is False + assert mapped.mate_is_forward is True + + assert unmapped.reference_id == sam.NO_REF_INDEX + assert unmapped.reference_name is None + assert unmapped.reference_start == sam.NO_REF_POS + assert unmapped.next_reference_id == unmapped.header.get_tid("chr1") + assert unmapped.next_reference_name == "chr1" + assert unmapped.next_reference_start == 200 + assert unmapped.has_tag("MC") + assert unmapped.get_tag("MC") == "100M" + assert unmapped.has_tag("MQ") + assert unmapped.get_tag("MQ") == 60 + assert unmapped.has_tag("ms") + assert unmapped.get_tag("ms") == 3000 + assert unmapped.template_length == 0 + assert unmapped.is_forward is True + assert unmapped.is_proper_pair is False + assert unmapped.mate_is_forward is False + + +def test_set_mate_info_both_mapped() -> None: + """Test set_mate_info sets mate info for two mapped records.""" + builder = SamBuilder() + r1, r2 = builder.add_pair(chrom="chr1", start1=200, start2=300) + assert r1.is_mapped is True + assert r2.is_mapped is True + + set_mate_info(r1, r2) + + for rec in (r1, r2): + assert rec.reference_id == builder.header.get_tid("chr1") + assert rec.reference_name == "chr1" + assert rec.next_reference_id == builder.header.get_tid("chr1") + assert rec.next_reference_name == "chr1" + assert rec.has_tag("MC") + assert rec.get_tag("MC") == "100M" + assert rec.has_tag("MQ") + assert rec.get_tag("MQ") == 60 + assert rec.has_tag("ms") + assert rec.get_tag("ms") == 3000 + assert rec.is_proper_pair is True + + assert r1.reference_start == 200 + assert r1.next_reference_start == 300 + assert r2.reference_start == 300 + assert r2.next_reference_start == 200 + assert r1.template_length == 200 + assert r2.template_length == -200 + assert r1.is_forward is True + assert r2.is_reverse is True + assert r1.mate_is_reverse is True + assert r2.mate_is_forward is True From d8b2c42763c86a5390af576fa67fbf6467836507 Mon Sep 17 00:00:00 2001 From: clintval Date: Fri, 27 Dec 2024 11:07:02 -0500 Subject: [PATCH 12/36] chore: fixup a tiny regression --- fgpyo/sam/__init__.py | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/fgpyo/sam/__init__.py b/fgpyo/sam/__init__.py index d9ad5b49..25ed60b5 100644 --- a/fgpyo/sam/__init__.py +++ b/fgpyo/sam/__init__.py @@ -879,7 +879,7 @@ def set_pair_info(r1: AlignedSegment, r2: AlignedSegment, proper_pair: bool = Tr r1.is_read2 = False r2.is_read2 = True r2.is_read1 = False - set_mate_info(r1=r1, r2=r2, is_proper_pair=is_proper_pair) + set_mate_info(r1=r1, r2=r2, is_proper_pair=lambda a, b: proper_pair) @attr.s(frozen=True, auto_attribs=True) From a53f73505e717a9ca0f01656178aef17b410d8f0 Mon Sep 17 00:00:00 2001 From: clintval Date: Fri, 27 Dec 2024 11:07:43 -0500 Subject: [PATCH 13/36] chore: deprecation after instead of since --- fgpyo/sam/__init__.py | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/fgpyo/sam/__init__.py b/fgpyo/sam/__init__.py index 25ed60b5..8cd1b8c3 100644 --- a/fgpyo/sam/__init__.py +++ b/fgpyo/sam/__init__.py @@ -857,7 +857,7 @@ def set_mate_info( r2.is_proper_pair = proper_pair -@deprecated("Use `set_mate_info()` instead. Deprecated as of fgpyo 0.8.0.") +@deprecated("Use `set_mate_info()` instead. Deprecated after fgpyo 0.8.0.") def set_pair_info(r1: AlignedSegment, r2: AlignedSegment, proper_pair: bool = True) -> None: """Resets mate pair information between reads in a pair. From 6f3c514ed48c8cbd6dc4f69eafa50b06f871201c Mon Sep 17 00:00:00 2001 From: clintval Date: Fri, 27 Dec 2024 11:42:50 -0500 Subject: [PATCH 14/36] chore: change param names --- fgpyo/sam/__init__.py | 84 +++++++++++++++++++++---------------------- 1 file changed, 42 insertions(+), 42 deletions(-) diff --git a/fgpyo/sam/__init__.py b/fgpyo/sam/__init__.py index f5c7404a..81e7e688 100644 --- a/fgpyo/sam/__init__.py +++ b/fgpyo/sam/__init__.py @@ -622,45 +622,45 @@ class PairOrientation(enum.Enum): @classmethod def build( - cls, r1: AlignedSegment, r2: Optional[AlignedSegment] = None + cls, rec1: AlignedSegment, rec2: Optional[AlignedSegment] = None ) -> Optional["PairOrientation"]: """Returns the pair orientation if both reads are mapped to the same reference sequence. Args: - r1: The first read in the template. - r2: The second read in the template. If undefined, mate data set upon R1 will be used. + rec1: The first record in the pair. + rec2: The second record in the pair. If None, then mate info on `rec1` will be used. See: [`htsjdk.samtools.SamPairUtil.getPairOrientation()`](https://github.com/samtools/htsjdk/blob/c31bc92c24bc4e9552b2a913e52286edf8f8ab96/src/main/java/htsjdk/samtools/SamPairUtil.java#L71-L102) """ - if r2 is None: - r2_is_unmapped = r1.mate_is_unmapped - r2_reference_id = r1.next_reference_id + if rec2 is None: + rec2_is_unmapped = rec1.mate_is_unmapped + rec2_reference_id = rec1.next_reference_id else: - r2_is_unmapped = r2.is_unmapped - r2_reference_id = r2.reference_id + rec2_is_unmapped = rec2.is_unmapped + rec2_reference_id = rec2.reference_id - if r1.is_unmapped or r2_is_unmapped or r1.reference_id != r2_reference_id: + if rec1.is_unmapped or rec2_is_unmapped or rec1.reference_id != rec2_reference_id: return None - if r2 is None: - if not r1.has_tag("MC"): + if rec2 is None: + if not rec1.has_tag("MC"): raise ValueError('Cannot determine proper pair status without R2\'s cigar ("MC")!') - r2_cigar = Cigar.from_cigarstring(str(r1.get_tag("MC"))) - r2_is_forward = r1.mate_is_forward - r2_reference_start = r1.next_reference_start - r2_reference_end = r1.next_reference_start + r2_cigar.length_on_target() + rec2_cigar = Cigar.from_cigarstring(str(rec1.get_tag("MC"))) + rec2_is_forward = rec1.mate_is_forward + rec2_reference_start = rec1.next_reference_start + rec2_reference_end = rec1.next_reference_start + rec2_cigar.length_on_target() else: - r2_is_forward = r2.is_forward - r2_reference_start = r2.reference_start - r2_reference_end = r2.reference_end + rec2_is_forward = rec2.is_forward + rec2_reference_start = rec2.reference_start + rec2_reference_end = rec2.reference_end - if r1.is_forward is r2_is_forward: + if rec1.is_forward is rec2_is_forward: return PairOrientation.TANDEM - elif r1.is_forward and r1.reference_start < r2_reference_end: + elif rec1.is_forward and rec1.reference_start < rec2_reference_end: return PairOrientation.FR - elif r1.is_reverse and r2_reference_start < r1.reference_end: + elif rec1.is_reverse and rec2_reference_start < rec1.reference_end: return PairOrientation.FR else: return PairOrientation.RF @@ -671,43 +671,43 @@ def build( def is_proper_pair( - r1: AlignedSegment, - r2: Optional[AlignedSegment] = None, + rec1: AlignedSegment, + rec2: Optional[AlignedSegment] = None, max_insert_size: int = 1000, orientations: set[PairOrientation] = DefaultProperlyPairedOrientations, ) -> bool: - """Determines if a read pair is properly paired or not. + """Determines if a pair of records are properly paired or not. - Criteria for reads in a proper pair are: - - Both reads are aligned - - Both reads are aligned to the same reference sequence - - The pair orientation of the reads is a part of the valid pair orientations (default "FR") + Criteria for records in a proper pair are: + - Both records are aligned + - Both records are aligned to the same reference sequence + - The pair orientation of the records is one of the valid pair orientations (default "FR") - The inferred insert size is not more than a maximum length (default 1000) Args: - r1: The first read in the template. - r2: The second read in the template. If undefined, mate data set upon R1 will be used. - max_insert_size: The maximum insert size to consider a read pair "proper". - orientations: The valid set of orientations to consider a read pair "proper". + rec1: The first record in the pair. + rec2: The second record in the pair. If None, then mate info on `rec1` will be used. + max_insert_size: The maximum insert size to consider a pair "proper". + orientations: The valid set of orientations to consider a pair "proper". See: [`htsjdk.samtools.SamPairUtil.isProperPair()`](https://github.com/samtools/htsjdk/blob/c31bc92c24bc4e9552b2a913e52286edf8f8ab96/src/main/java/htsjdk/samtools/SamPairUtil.java#L106-L125) """ - if r2 is None: - r2_is_mapped = r1.mate_is_mapped - r2_reference_id = r1.next_reference_id + if rec2 is None: + rec2_is_mapped = rec1.mate_is_mapped + rec2_reference_id = rec1.next_reference_id else: - r2_is_mapped = r2.is_mapped - r2_reference_id = r2.reference_id + rec2_is_mapped = rec2.is_mapped + rec2_reference_id = rec2.reference_id return ( - r1.is_mapped - and r2_is_mapped - and r1.reference_id == r2_reference_id - and PairOrientation.build(r1, r2) in orientations + rec1.is_mapped + and rec2_is_mapped + and rec1.reference_id == rec2_reference_id + and PairOrientation.build(rec1=rec1, rec2=rec2) in orientations # TODO: consider replacing with `abs(isize(r1, r2)) <= max_insert_size` # which can only be done if isize() is modified to allow for an optional R2. - and 0 < abs(r1.template_length) <= max_insert_size + and 0 < abs(rec1.template_length) <= max_insert_size ) From 4e64644fc0176bc93bfa32e4ed6f7a9e61118b06 Mon Sep 17 00:00:00 2001 From: clintval Date: Fri, 27 Dec 2024 11:44:03 -0500 Subject: [PATCH 15/36] chore: make arg more generically typed --- fgpyo/sam/__init__.py | 5 +++-- 1 file changed, 3 insertions(+), 2 deletions(-) diff --git a/fgpyo/sam/__init__.py b/fgpyo/sam/__init__.py index 81e7e688..fcf1f444 100644 --- a/fgpyo/sam/__init__.py +++ b/fgpyo/sam/__init__.py @@ -158,6 +158,7 @@ import enum import io import sys +from collections.abc import Collection from itertools import chain from pathlib import Path from typing import IO @@ -666,7 +667,7 @@ def build( return PairOrientation.RF -DefaultProperlyPairedOrientations = {PairOrientation.FR} +DefaultProperlyPairedOrientations: set[PairOrientation] = {PairOrientation.FR} """The default orientations for properly paired reads.""" @@ -674,7 +675,7 @@ def is_proper_pair( rec1: AlignedSegment, rec2: Optional[AlignedSegment] = None, max_insert_size: int = 1000, - orientations: set[PairOrientation] = DefaultProperlyPairedOrientations, + orientations: Collection[PairOrientation] = DefaultProperlyPairedOrientations, ) -> bool: """Determines if a pair of records are properly paired or not. From 8c4ce6fbfd686c415cc52ef6c7a0912dd10ccf1d Mon Sep 17 00:00:00 2001 From: clintval Date: Fri, 27 Dec 2024 15:37:57 -0500 Subject: [PATCH 16/36] feat: only grab the mate cigar if absolutely necessary --- fgpyo/sam/__init__.py | 26 +++++++---- tests/fgpyo/sam/test_sam.py | 86 +++++++++++++++++++++++-------------- 2 files changed, 71 insertions(+), 41 deletions(-) diff --git a/fgpyo/sam/__init__.py b/fgpyo/sam/__init__.py index fcf1f444..2a027fc2 100644 --- a/fgpyo/sam/__init__.py +++ b/fgpyo/sam/__init__.py @@ -622,7 +622,7 @@ class PairOrientation(enum.Enum): """A pair orientation for tandem (forward-forward or reverse-reverse) reads.""" @classmethod - def build( + def from_recs( # noqa: C901 # `from_recs` is too complex (11 > 10) cls, rec1: AlignedSegment, rec2: Optional[AlignedSegment] = None ) -> Optional["PairOrientation"]: """Returns the pair orientation if both reads are mapped to the same reference sequence. @@ -646,22 +646,30 @@ def build( return None if rec2 is None: - if not rec1.has_tag("MC"): - raise ValueError('Cannot determine proper pair status without R2\'s cigar ("MC")!') - rec2_cigar = Cigar.from_cigarstring(str(rec1.get_tag("MC"))) rec2_is_forward = rec1.mate_is_forward rec2_reference_start = rec1.next_reference_start - rec2_reference_end = rec1.next_reference_start + rec2_cigar.length_on_target() else: rec2_is_forward = rec2.is_forward rec2_reference_start = rec2.reference_start - rec2_reference_end = rec2.reference_end if rec1.is_forward is rec2_is_forward: return PairOrientation.TANDEM - elif rec1.is_forward and rec1.reference_start < rec2_reference_end: + if rec1.is_forward and rec1.reference_start <= rec2_reference_start: + return PairOrientation.FR + if rec1.is_reverse and rec2_reference_start < rec1.reference_end: return PairOrientation.FR - elif rec1.is_reverse and rec2_reference_start < rec1.reference_end: + if rec1.is_reverse and rec2_reference_start >= rec1.reference_end: + return PairOrientation.RF + + if rec2 is None: + if not rec1.has_tag("MC"): + raise ValueError('Cannot determine proper pair status without R2\'s cigar ("MC")!') + rec2_cigar = Cigar.from_cigarstring(str(rec1.get_tag("MC"))) + rec2_reference_end = rec1.next_reference_start + rec2_cigar.length_on_target() + else: + rec2_reference_end = rec2.reference_end + + if rec1.reference_start < rec2_reference_end: return PairOrientation.FR else: return PairOrientation.RF @@ -705,7 +713,7 @@ def is_proper_pair( rec1.is_mapped and rec2_is_mapped and rec1.reference_id == rec2_reference_id - and PairOrientation.build(rec1=rec1, rec2=rec2) in orientations + and PairOrientation.from_recs(rec1=rec1, rec2=rec2) in orientations # TODO: consider replacing with `abs(isize(r1, r2)) <= max_insert_size` # which can only be done if isize() is modified to allow for an optional R2. and 0 < abs(rec1.template_length) <= max_insert_size diff --git a/tests/fgpyo/sam/test_sam.py b/tests/fgpyo/sam/test_sam.py index 5ac6639b..6269af1f 100755 --- a/tests/fgpyo/sam/test_sam.py +++ b/tests/fgpyo/sam/test_sam.py @@ -306,39 +306,60 @@ def test_pair_orientation_build_with_r2() -> None: """Test that we can build all pair orientations with R1 and R2.""" builder = SamBuilder() r1, r2 = builder.add_pair(chrom="chr1", start1=100, cigar1="115M", start2=250, cigar2="40M") - assert PairOrientation.build(r1, r2) is PairOrientation.FR + assert PairOrientation.from_recs(r1, r2) is PairOrientation.FR + assert PairOrientation.from_recs(r1) is PairOrientation.FR + assert PairOrientation.from_recs(r2) is PairOrientation.FR r1, r2 = builder.add_pair(chrom="chr1", start1=100, cigar1="115M", start2=250, cigar2="40M") r1.is_forward = False r2.is_forward = True sam.set_pair_info(r1, r2) - assert PairOrientation.build(r1, r2) is PairOrientation.RF + assert PairOrientation.from_recs(r1, r2) is PairOrientation.RF + assert PairOrientation.from_recs(r1) is PairOrientation.RF + assert PairOrientation.from_recs(r2) is PairOrientation.RF r1, r2 = builder.add_pair(chrom="chr1", start1=100, cigar1="115M", start2=250, cigar2="40M") r1.is_forward = True r2.is_forward = True sam.set_pair_info(r1, r2) - assert PairOrientation.build(r1, r2) is PairOrientation.TANDEM + assert PairOrientation.from_recs(r1, r2) is PairOrientation.TANDEM + assert PairOrientation.from_recs(r1) is PairOrientation.TANDEM + assert PairOrientation.from_recs(r2) is PairOrientation.TANDEM r1, r2 = builder.add_pair(chrom="chr1", start1=100, cigar1="115M", start2=250, cigar2="40M") r1.is_forward = False r2.is_forward = False sam.set_pair_info(r1, r2) - assert PairOrientation.build(r1, r2) is PairOrientation.TANDEM + assert PairOrientation.from_recs(r1, r2) is PairOrientation.TANDEM + assert PairOrientation.from_recs(r1) is PairOrientation.TANDEM + assert PairOrientation.from_recs(r2) is PairOrientation.TANDEM def test_pair_orientation_is_fr_if_opposite_directions_and_overlapping() -> None: """Test the pair orientation is always FR if the reads overlap and are oriented opposite.""" builder = SamBuilder() r1, r2 = builder.add_pair(chrom="chr1", start1=100, cigar1="10M", start2=100, cigar2="10M") - assert PairOrientation.build(r1, r2) is PairOrientation.FR + assert PairOrientation.from_recs(r1, r2) is PairOrientation.FR + assert PairOrientation.from_recs(r1) is PairOrientation.FR + assert PairOrientation.from_recs(r2) is PairOrientation.FR builder = SamBuilder() r1, r2 = builder.add_pair(chrom="chr1", start1=100, cigar1="10M", start2=100, cigar2="10M") r1.is_reverse = True r2.is_reverse = False sam.set_pair_info(r1, r2) - assert PairOrientation.build(r1, r2) is PairOrientation.FR + assert PairOrientation.from_recs(r1, r2) is PairOrientation.FR + assert PairOrientation.from_recs(r1) is PairOrientation.FR + assert PairOrientation.from_recs(r2) is PairOrientation.FR + + +def test_a_single_bp_alignment_at_end_of_rec_one_is_still_fr_orientations() -> None: + """Test a single bp alignment at the end of a mate's alignment is still FR based on rec1.""" + builder = SamBuilder() + r1, r2 = builder.add_pair(chrom="chr1", start1=5, cigar1="5M", start2=5, cigar2="1M") + assert PairOrientation.from_recs(r1, r2) is PairOrientation.FR + assert PairOrientation.from_recs(r1) is PairOrientation.FR + assert PairOrientation.from_recs(r2) is PairOrientation.FR def test_pair_orientation_build_with_either_unmapped() -> None: @@ -347,75 +368,76 @@ def test_pair_orientation_build_with_either_unmapped() -> None: r1, r2 = builder.add_pair() assert r1.is_unmapped assert r2.is_unmapped - assert PairOrientation.build(r1, r2) is None + assert PairOrientation.from_recs(r1, r2) is None + assert PairOrientation.from_recs(r1) is None + assert PairOrientation.from_recs(r2) is None r1, r2 = builder.add_pair(chrom="chr1", start1=100) assert r1.is_mapped assert r2.is_unmapped - assert PairOrientation.build(r1, r2) is None + assert PairOrientation.from_recs(r1, r2) is None + assert PairOrientation.from_recs(r1) is None + assert PairOrientation.from_recs(r2) is None r1, r2 = builder.add_pair(chrom="chr1", start2=100) assert r1.is_unmapped assert r2.is_mapped - assert PairOrientation.build(r1, r2) is None + assert PairOrientation.from_recs(r1, r2) is None + assert PairOrientation.from_recs(r1) is None + assert PairOrientation.from_recs(r2) is None def test_pair_orientation_build_with_no_r2_but_r2_mapped() -> None: """Test that we can build all pair orientations with R1 and no R2, but R2 is mapped.""" builder = SamBuilder() r1, r2 = builder.add_pair(chrom="chr1", start1=100, cigar1="115M", start2=250, cigar2="40M") - assert PairOrientation.build(r1) is PairOrientation.FR + assert PairOrientation.from_recs(r1) is PairOrientation.FR r1, r2 = builder.add_pair(chrom="chr1", start1=100, cigar1="115M", start2=250, cigar2="40M") r1.is_forward = False r2.is_forward = True sam.set_pair_info(r1, r2) - assert PairOrientation.build(r1) is PairOrientation.RF + assert PairOrientation.from_recs(r1) is PairOrientation.RF r1, r2 = builder.add_pair(chrom="chr1", start1=100, cigar1="115M", start2=250, cigar2="40M") r1.is_forward = True r2.is_forward = True sam.set_pair_info(r1, r2) - assert PairOrientation.build(r1) is PairOrientation.TANDEM + assert PairOrientation.from_recs(r1) is PairOrientation.TANDEM r1, r2 = builder.add_pair(chrom="chr1", start1=100, cigar1="115M", start2=250, cigar2="40M") r1.is_forward = False r2.is_forward = False sam.set_pair_info(r1, r2) - assert PairOrientation.build(r1) is PairOrientation.TANDEM + assert PairOrientation.from_recs(r1) is PairOrientation.TANDEM -def test_pair_orientation_build_with_either_unmapped_but_no_r2() -> None: - """Test that we can return None with either R1 and R2 unmapped (or both), but no R2.""" +def test_pair_orientation_build_raises_if_it_cant_find_mate_cigar_tag_positive_fr() -> None: + """Test that an exception is raised if we cannot find the mate cigar tag.""" builder = SamBuilder() - r1, r2 = builder.add_pair() - assert r1.is_unmapped - assert r2.is_unmapped + r1, r2 = builder.add_pair(chrom="chr1", start1=16, cigar1="10M", start2=15, cigar2="10M") sam.set_pair_info(r1, r2) - assert PairOrientation.build(r1) is None + r1.set_tag("MC", None) # Clear out the MC tag. + r2.set_tag("MC", None) # Clear out the MC tag. - r1, r2 = builder.add_pair(chrom="chr1", start1=100) - assert r1.is_mapped - assert r2.is_unmapped - sam.set_pair_info(r1, r2) - assert PairOrientation.build(r1) is None + with pytest.raises(ValueError): + PairOrientation.from_recs(r1) - r1, r2 = builder.add_pair(chrom="chr1", start2=100) - assert r1.is_unmapped - assert r2.is_mapped - sam.set_pair_info(r1, r2) - assert PairOrientation.build(r1) is None + assert PairOrientation.from_recs(r2) is PairOrientation.FR -def test_pair_orientation_build_raises_if_it_cant_find_mate_cigar_tag() -> None: +def test_pair_orientation_build_raises_if_it_cant_find_mate_cigar_tag_positive_rf() -> None: """Test that an exception is raised if we cannot find the mate cigar tag.""" builder = SamBuilder() - r1, r2 = builder.add_pair(chrom="chr1", start1=10, start2=30) + r1, r2 = builder.add_pair(chrom="chr1", start1=16, cigar1="1M", start2=15, cigar2="1M") sam.set_pair_info(r1, r2) r1.set_tag("MC", None) # Clear out the MC tag. + r2.set_tag("MC", None) # Clear out the MC tag. with pytest.raises(ValueError): - PairOrientation.build(r1) + PairOrientation.from_recs(r1) + + assert PairOrientation.from_recs(r2) is PairOrientation.RF def test_is_proper_pair_when_actually_proper() -> None: From dc17e0d86409146a25203590b02569843ba1cb66 Mon Sep 17 00:00:00 2001 From: clintval Date: Fri, 27 Dec 2024 15:39:22 -0500 Subject: [PATCH 17/36] chore: ensure 100% test coverage on diff --- tests/fgpyo/sam/test_sam.py | 5 +++++ 1 file changed, 5 insertions(+) diff --git a/tests/fgpyo/sam/test_sam.py b/tests/fgpyo/sam/test_sam.py index 6269af1f..db808595 100755 --- a/tests/fgpyo/sam/test_sam.py +++ b/tests/fgpyo/sam/test_sam.py @@ -420,6 +420,8 @@ def test_pair_orientation_build_raises_if_it_cant_find_mate_cigar_tag_positive_f r1.set_tag("MC", None) # Clear out the MC tag. r2.set_tag("MC", None) # Clear out the MC tag. + assert PairOrientation.from_recs(r1, r2) is PairOrientation.FR + with pytest.raises(ValueError): PairOrientation.from_recs(r1) @@ -431,6 +433,9 @@ def test_pair_orientation_build_raises_if_it_cant_find_mate_cigar_tag_positive_r builder = SamBuilder() r1, r2 = builder.add_pair(chrom="chr1", start1=16, cigar1="1M", start2=15, cigar2="1M") sam.set_pair_info(r1, r2) + + assert PairOrientation.from_recs(r1, r2) is PairOrientation.RF + r1.set_tag("MC", None) # Clear out the MC tag. r2.set_tag("MC", None) # Clear out the MC tag. From 935184b9175bb1972656c4c70b3feaa7a0f6dab4 Mon Sep 17 00:00:00 2001 From: clintval Date: Fri, 27 Dec 2024 15:48:09 -0500 Subject: [PATCH 18/36] chore: remove reference to R2 --- fgpyo/sam/__init__.py | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/fgpyo/sam/__init__.py b/fgpyo/sam/__init__.py index 2a027fc2..62328b12 100644 --- a/fgpyo/sam/__init__.py +++ b/fgpyo/sam/__init__.py @@ -663,7 +663,7 @@ def from_recs( # noqa: C901 # `from_recs` is too complex (11 > 10) if rec2 is None: if not rec1.has_tag("MC"): - raise ValueError('Cannot determine proper pair status without R2\'s cigar ("MC")!') + raise ValueError('Cannot determine proper pair status without a mate cigar ("MC")!') rec2_cigar = Cigar.from_cigarstring(str(rec1.get_tag("MC"))) rec2_reference_end = rec1.next_reference_start + rec2_cigar.length_on_target() else: From 8a4973bb254d22b41c546b7535b7d5dd6d786b1b Mon Sep 17 00:00:00 2001 From: clintval Date: Fri, 27 Dec 2024 16:37:55 -0500 Subject: [PATCH 19/36] chore: fixup based on review --- fgpyo/sam/__init__.py | 57 +++++++++++++++++++++++-------------- tests/fgpyo/sam/test_sam.py | 14 +++++---- 2 files changed, 44 insertions(+), 27 deletions(-) diff --git a/fgpyo/sam/__init__.py b/fgpyo/sam/__init__.py index 1d80beb8..a8d465f0 100644 --- a/fgpyo/sam/__init__.py +++ b/fgpyo/sam/__init__.py @@ -677,33 +677,48 @@ def from_recs( # noqa: C901 # `from_recs` is too complex (11 > 10) return PairOrientation.RF -def isize(r1: AlignedSegment, r2: Optional[AlignedSegment] = None) -> int: - """Computes the insert size for a pair of records.""" - if r2 is None: - r2_is_unmapped = r1.mate_is_unmapped - r2_reference_id = r1.next_reference_id +def isize(rec1: AlignedSegment, rec2: Optional[AlignedSegment] = None) -> int: + """Computes the insert size ("template length" or "TLEN") for a pair of records. + + Args: + rec1: The first record in the pair. + rec2: The second record in the pair. If None, then mate info on `rec1` will be used. + + """ + if rec2 is None: + rec2_is_unmapped = rec1.mate_is_unmapped + rec2_reference_id = rec1.next_reference_id else: - r2_is_unmapped = r2.is_unmapped - r2_reference_id = r2.reference_id + rec2_is_unmapped = rec2.is_unmapped + rec2_reference_id = rec2.reference_id - if r1.is_unmapped or r2_is_unmapped or r1.reference_id != r2_reference_id: + if rec1.is_unmapped or rec2_is_unmapped or rec1.reference_id != rec2_reference_id: return 0 - if r2 is None: - if not r1.has_tag("MC"): - raise ValueError('Cannot determine proper pair status without R2\'s cigar ("MC")!') - r2_cigar = Cigar.from_cigarstring(str(r1.get_tag("MC"))) - r2_is_reverse = r1.mate_is_reverse - r2_reference_start = r1.next_reference_start - r2_reference_end = r1.next_reference_start + r2_cigar.length_on_target() + if rec2 is None: + rec2_is_forward = rec1.mate_is_forward + rec2_reference_start = rec1.next_reference_start else: - r2_is_reverse = r2.is_reverse - r2_reference_start = r2.reference_start - r2_reference_end = r2.reference_end + rec2_is_forward = rec2.is_forward + rec2_reference_start = rec2.reference_start - r1_pos = r1.reference_end if r1.is_reverse else r1.reference_start - r2_pos = r2_reference_end if r2_is_reverse else r2_reference_start - return r2_pos - r1_pos + if rec1.is_forward and rec2_is_forward: + return rec2_reference_start - rec1.reference_start + if rec1.is_reverse and rec2_is_forward: + return rec2_reference_start - rec1.reference_end + + if rec2 is None: + if not rec1.has_tag("MC"): + raise ValueError('Cannot determine proper pair status without a mate cigar ("MC")!') + rec2_cigar = Cigar.from_cigarstring(str(rec1.get_tag("MC"))) + rec2_reference_end = rec1.next_reference_start + rec2_cigar.length_on_target() + else: + rec2_reference_end = rec2.reference_end + + if rec1.is_forward: + return rec2_reference_end - rec1.reference_start + else: + return rec2_reference_end - rec1.reference_end DefaultProperlyPairedOrientations: set[PairOrientation] = {PairOrientation.FR} diff --git a/tests/fgpyo/sam/test_sam.py b/tests/fgpyo/sam/test_sam.py index acbba6c2..b5b6fc93 100755 --- a/tests/fgpyo/sam/test_sam.py +++ b/tests/fgpyo/sam/test_sam.py @@ -594,7 +594,9 @@ def test_isize_raises_when_r2_not_provided_and_no_mate_cigar_tag() -> None: builder = SamBuilder() r1, _ = builder.add_pair(chrom="chr1", start1=100, cigar1="115M", start2=250, cigar2="40M") r1.set_tag("MC", None) - with pytest.raises(ValueError, match="Cannot determine proper pair status without R2's cigar"): + with pytest.raises( + ValueError, match="Cannot determine proper pair status without a mate cigar" + ): sam.isize(r1) @@ -769,7 +771,7 @@ def test_set_mate_info_one_unmapped() -> None: def test_set_mate_info_both_mapped() -> None: """Test set_mate_info sets mate info for two mapped records.""" builder = SamBuilder() - r1, r2 = builder.add_pair(chrom="chr1", start1=200, start2=300) + r1, r2 = builder.add_pair(chrom="chr1", start1=200, start2=301) assert r1.is_mapped is True assert r2.is_mapped is True @@ -789,11 +791,11 @@ def test_set_mate_info_both_mapped() -> None: assert rec.is_proper_pair is True assert r1.reference_start == 200 - assert r1.next_reference_start == 300 - assert r2.reference_start == 300 + assert r1.next_reference_start == 301 + assert r2.reference_start == 301 assert r2.next_reference_start == 200 - assert r1.template_length == 200 - assert r2.template_length == -200 + assert r1.template_length == 201 + assert r2.template_length == -201 assert r1.is_forward is True assert r2.is_reverse is True assert r1.mate_is_reverse is True From f858479f3c830cd77f6586bfab56226b65c6c0b8 Mon Sep 17 00:00:00 2001 From: clintval Date: Fri, 27 Dec 2024 16:40:37 -0500 Subject: [PATCH 20/36] chore: remove extra newline --- fgpyo/sam/__init__.py | 1 - 1 file changed, 1 deletion(-) diff --git a/fgpyo/sam/__init__.py b/fgpyo/sam/__init__.py index a8d465f0..1071025e 100644 --- a/fgpyo/sam/__init__.py +++ b/fgpyo/sam/__init__.py @@ -683,7 +683,6 @@ def isize(rec1: AlignedSegment, rec2: Optional[AlignedSegment] = None) -> int: Args: rec1: The first record in the pair. rec2: The second record in the pair. If None, then mate info on `rec1` will be used. - """ if rec2 is None: rec2_is_unmapped = rec1.mate_is_unmapped From 06938d7b045365946d906cdbdd49e2df3c5f32fd Mon Sep 17 00:00:00 2001 From: clintval Date: Fri, 27 Dec 2024 16:42:32 -0500 Subject: [PATCH 21/36] chore: remove small change in tests --- tests/fgpyo/sam/test_sam.py | 10 +++++----- 1 file changed, 5 insertions(+), 5 deletions(-) diff --git a/tests/fgpyo/sam/test_sam.py b/tests/fgpyo/sam/test_sam.py index b5b6fc93..7b4d5bd4 100755 --- a/tests/fgpyo/sam/test_sam.py +++ b/tests/fgpyo/sam/test_sam.py @@ -771,7 +771,7 @@ def test_set_mate_info_one_unmapped() -> None: def test_set_mate_info_both_mapped() -> None: """Test set_mate_info sets mate info for two mapped records.""" builder = SamBuilder() - r1, r2 = builder.add_pair(chrom="chr1", start1=200, start2=301) + r1, r2 = builder.add_pair(chrom="chr1", start1=200, start2=300) assert r1.is_mapped is True assert r2.is_mapped is True @@ -791,11 +791,11 @@ def test_set_mate_info_both_mapped() -> None: assert rec.is_proper_pair is True assert r1.reference_start == 200 - assert r1.next_reference_start == 301 - assert r2.reference_start == 301 + assert r1.next_reference_start == 300 + assert r2.reference_start == 300 assert r2.next_reference_start == 200 - assert r1.template_length == 201 - assert r2.template_length == -201 + assert r1.template_length == 200 + assert r2.template_length == -200 assert r1.is_forward is True assert r2.is_reverse is True assert r1.mate_is_reverse is True From 6dea88175d5427d1bde59c5e737af7c71f840e27 Mon Sep 17 00:00:00 2001 From: clintval Date: Fri, 27 Dec 2024 16:45:40 -0500 Subject: [PATCH 22/36] chore: add another test --- tests/fgpyo/sam/test_sam.py | 10 +++++++--- 1 file changed, 7 insertions(+), 3 deletions(-) diff --git a/tests/fgpyo/sam/test_sam.py b/tests/fgpyo/sam/test_sam.py index 7b4d5bd4..e822ee51 100755 --- a/tests/fgpyo/sam/test_sam.py +++ b/tests/fgpyo/sam/test_sam.py @@ -589,11 +589,15 @@ def test_isize_when_r2_undefined_indels_in_r2_cigar() -> None: assert sam.isize(r1) == 190 -def test_isize_raises_when_r2_not_provided_and_no_mate_cigar_tag() -> None: - """Tests that an insert size can be calculated when both input records are defined.""" +def test_isize_raises_when_r2_not_provided_and_mate_cigar_tag_unset_r1() -> None: + """Tests an exception is raised when the mate cigar tag is not on rec1 and rec2 is missing.""" builder = SamBuilder() - r1, _ = builder.add_pair(chrom="chr1", start1=100, cigar1="115M", start2=250, cigar2="40M") + r1, r2 = builder.add_pair(chrom="chr1", start1=100, cigar1="115M", start2=250, cigar2="40M") + r1.set_tag("MC", None) + + assert sam.isize(r2) == -190 + with pytest.raises( ValueError, match="Cannot determine proper pair status without a mate cigar" ): From ce520e1020db6551d01ac090c90b6c268dc19dc7 Mon Sep 17 00:00:00 2001 From: clintval Date: Fri, 27 Dec 2024 16:55:50 -0500 Subject: [PATCH 23/36] chore: extract common function to private func --- fgpyo/sam/__init__.py | 82 +++++++++++++++++++++++-------------------- 1 file changed, 44 insertions(+), 38 deletions(-) diff --git a/fgpyo/sam/__init__.py b/fgpyo/sam/__init__.py index f3969d44..2940d6b6 100644 --- a/fgpyo/sam/__init__.py +++ b/fgpyo/sam/__init__.py @@ -899,16 +899,44 @@ def set_mate_info( r2.is_proper_pair = proper_pair +def _set_non_primary_mate_fields( + secondary_or_supp: AlignedSegment, mate_primary: AlignedSegment +) -> None: + """Set mate info on a secondary or supplementary alignment to its mate's primary alignment. + + Args: + secondary_or_supp: A secondary or supplementary alignment. + mate_primary: The primary alignment of the secondary_or_supp mate. + """ + if ( + mate_primary.is_read1 == secondary_or_supp.is_read1 + or mate_primary.is_secondary + or mate_primary.is_supplementary + ): + raise ValueError("Mate info must be set from a primary of the next ordinal!") + if mate_primary.query_name != secondary_or_supp.query_name: + raise ValueError("Cannot set mate info on alignments with different query names!") + + secondary_or_supp.next_reference_id = mate_primary.reference_id + secondary_or_supp.next_reference_name = mate_primary.reference_name + secondary_or_supp.next_reference_start = mate_primary.reference_start + secondary_or_supp.mate_is_forward = mate_primary.is_forward + secondary_or_supp.mate_is_mapped = mate_primary.is_mapped + secondary_or_supp.set_tag("MC", mate_primary.cigarstring) + secondary_or_supp.set_tag("MQ", mate_primary.mapping_quality) + secondary_or_supp.set_tag("ms", sum_of_base_qualities(mate_primary)) + + def set_mate_info_on_secondary( - primary: AlignedSegment, secondary: AlignedSegment, + mate_primary: AlignedSegment, is_proper_pair: Callable[[AlignedSegment, AlignedSegment], bool] = is_proper_pair, ) -> None: - """Set mate info on a secondary alignment to the next read ordinal's primary alignment. + """Set mate info on a secondary alignment to its mate's primary alignment. Args: - primary: The primary alignment of the secondary's mate. secondary: The secondary alignment to set mate information upon. + mate_primary: The primary alignment of the secondary's mate. is_proper_pair: A function that takes the two alignments and determines proper pair status. Raises: @@ -916,59 +944,37 @@ def set_mate_info_on_secondary( ValueError: If the primary is marked as either secondary or supplementary. ValueError: If the secondary is not marked as secondary. """ - if primary.is_read1 == secondary.is_read1 or primary.is_secondary or primary.is_supplementary: - raise ValueError("Secondary mate info must be set from a primary of the next ordinal!") if not secondary.is_secondary: raise ValueError("Cannot set mate info on an alignment not marked as secondary!") - if primary.query_name != secondary.query_name: - raise ValueError("Cannot set mate info on alignments with different query names!") - secondary.next_reference_id = primary.reference_id - secondary.next_reference_name = primary.reference_name - secondary.next_reference_start = primary.reference_start - secondary.mate_is_forward = primary.is_forward - secondary.mate_is_mapped = primary.is_mapped - secondary.set_tag("MC", primary.cigarstring) - secondary.set_tag("MQ", primary.mapping_quality) - secondary.set_tag("ms", sum_of_base_qualities(primary)) + _set_non_primary_mate_fields(secondary_or_supp=secondary, mate_primary=mate_primary) # NB: calculate isize and proper pair as if this secondary alignment was the primary alignment. - secondary.is_proper_pair = is_proper_pair(primary, secondary) - secondary.template_length = isize(primary, secondary) + secondary.is_proper_pair = is_proper_pair(mate_primary, secondary) + secondary.template_length = isize(mate_primary, secondary) -def set_mate_info_on_supplementary(primary: AlignedSegment, supp: AlignedSegment) -> None: - """Set mate info on a supplementary alignment to the next read ordinal's primary alignment. +def set_mate_info_on_supplementary(supp: AlignedSegment, mate_primary: AlignedSegment) -> None: + """Set mate info on a supplementary alignment to its mate's primary alignment. Args: - primary: The primary alignment of the supplementary's mate. supp: The supplementary alignment to set mate information upon. + mate_primary: The primary alignment of the supplementary's mate. Raises: ValueError: If primary and secondary are of the same read ordinal. ValueError: If the primary is marked as either secondary or supplementary. ValueError: If the secondary is not marked as secondary. """ - if primary.is_read1 == supp.is_read1 or primary.is_secondary or primary.is_supplementary: - raise ValueError("Supplementary mate info must be set from a primary of the next ordinal!") if not supp.is_supplementary: raise ValueError("Cannot set mate info on an alignment not marked as supplementary!") - if primary.query_name != supp.query_name: - raise ValueError("Cannot set mate info on alignments with different query names!") - supp.next_reference_id = primary.reference_id - supp.next_reference_name = primary.reference_name - supp.next_reference_start = primary.reference_start - supp.mate_is_forward = primary.is_forward - supp.mate_is_mapped = primary.is_mapped - supp.set_tag("MC", primary.cigarstring) - supp.set_tag("MQ", primary.mapping_quality) - supp.set_tag("ms", sum_of_base_qualities(primary)) + _set_non_primary_mate_fields(secondary_or_supp=supp, mate_primary=mate_primary) # NB: for a non-secondary supplemental alignment, set the following to the same as the primary. if not supp.is_secondary: - supp.is_proper_pair = primary.is_proper_pair - supp.template_length = -primary.template_length + supp.is_proper_pair = mate_primary.is_proper_pair + supp.template_length = -mate_primary.template_length def set_as_pairs( @@ -1343,14 +1349,14 @@ def set_mate_info_for_template( set_mate_info(template.r1, template.r2, is_proper_pair=is_proper_pair) if template.r1 is not None: for rec in template.r2_secondaries: - set_mate_info_on_secondary(template.r1, rec, is_proper_pair=is_proper_pair) + set_mate_info_on_secondary(rec, template.r1, is_proper_pair=is_proper_pair) for rec in template.r2_supplementals: - set_mate_info_on_supplementary(template.r1, rec) + set_mate_info_on_supplementary(rec, template.r1) if template.r2 is not None: for rec in template.r1_secondaries: - set_mate_info_on_secondary(template.r2, rec, is_proper_pair=is_proper_pair) + set_mate_info_on_secondary(rec, template.r2, is_proper_pair=is_proper_pair) for rec in template.r1_supplementals: - set_mate_info_on_supplementary(template.r2, rec) + set_mate_info_on_supplementary(rec, template.r2) return template From 4c7f8b32b4f4de28811680ec96dbf4a02fa42b8d Mon Sep 17 00:00:00 2001 From: clintval Date: Fri, 27 Dec 2024 17:00:00 -0500 Subject: [PATCH 24/36] chore: further de-duplicate shared code --- fgpyo/sam/__init__.py | 67 +++++++++++++++++-------------------------- 1 file changed, 26 insertions(+), 41 deletions(-) diff --git a/fgpyo/sam/__init__.py b/fgpyo/sam/__init__.py index 2940d6b6..021a4fac 100644 --- a/fgpyo/sam/__init__.py +++ b/fgpyo/sam/__init__.py @@ -863,6 +863,28 @@ def sum_of_base_qualities(rec: AlignedSegment, min_quality_score: int = 15) -> i return score +def _set_common_mate_fields(dest: AlignedSegment, source: AlignedSegment) -> None: + """Set common mate info an alignment to its mate's primary alignment. + + Args: + dest: The alignment to set the mate info upon. + source: The primary alignment to use as a mate reference. + """ + if source.is_read1 is dest.is_read1 or source.is_secondary or source.is_supplementary: + raise ValueError("Mate info must be set from a primary of the next ordinal!") + if source.query_name != dest.query_name: + raise ValueError("Cannot set mate info on alignments with different query names!") + + dest.next_reference_id = source.reference_id + dest.next_reference_name = source.reference_name + dest.next_reference_start = source.reference_start + dest.mate_is_forward = source.is_forward + dest.mate_is_mapped = source.is_mapped + dest.set_tag("MC", source.cigarstring) + dest.set_tag("MQ", source.mapping_quality) + dest.set_tag("ms", sum_of_base_qualities(source)) + + def set_mate_info( r1: AlignedSegment, r2: AlignedSegment, @@ -878,17 +900,8 @@ def set_mate_info( if r1.query_name != r2.query_name: raise ValueError("Cannot set mate info on alignments with different query names!") - for src, dest in [(r1, r2), (r2, r1)]: - dest.next_reference_id = src.reference_id - dest.next_reference_name = src.reference_name - dest.next_reference_start = src.reference_start - dest.mate_is_forward = src.is_forward - dest.mate_is_mapped = src.is_mapped - dest.set_tag("MC", src.cigarstring) - dest.set_tag("MQ", src.mapping_quality) - - r1.set_tag("ms", sum_of_base_qualities(r2)) - r2.set_tag("ms", sum_of_base_qualities(r1)) + for dest, source in [(r1, r2), (r2, r1)]: + _set_common_mate_fields(dest=dest, source=source) template_length = isize(r1, r2) r1.template_length = template_length @@ -899,34 +912,6 @@ def set_mate_info( r2.is_proper_pair = proper_pair -def _set_non_primary_mate_fields( - secondary_or_supp: AlignedSegment, mate_primary: AlignedSegment -) -> None: - """Set mate info on a secondary or supplementary alignment to its mate's primary alignment. - - Args: - secondary_or_supp: A secondary or supplementary alignment. - mate_primary: The primary alignment of the secondary_or_supp mate. - """ - if ( - mate_primary.is_read1 == secondary_or_supp.is_read1 - or mate_primary.is_secondary - or mate_primary.is_supplementary - ): - raise ValueError("Mate info must be set from a primary of the next ordinal!") - if mate_primary.query_name != secondary_or_supp.query_name: - raise ValueError("Cannot set mate info on alignments with different query names!") - - secondary_or_supp.next_reference_id = mate_primary.reference_id - secondary_or_supp.next_reference_name = mate_primary.reference_name - secondary_or_supp.next_reference_start = mate_primary.reference_start - secondary_or_supp.mate_is_forward = mate_primary.is_forward - secondary_or_supp.mate_is_mapped = mate_primary.is_mapped - secondary_or_supp.set_tag("MC", mate_primary.cigarstring) - secondary_or_supp.set_tag("MQ", mate_primary.mapping_quality) - secondary_or_supp.set_tag("ms", sum_of_base_qualities(mate_primary)) - - def set_mate_info_on_secondary( secondary: AlignedSegment, mate_primary: AlignedSegment, @@ -947,7 +932,7 @@ def set_mate_info_on_secondary( if not secondary.is_secondary: raise ValueError("Cannot set mate info on an alignment not marked as secondary!") - _set_non_primary_mate_fields(secondary_or_supp=secondary, mate_primary=mate_primary) + _set_common_mate_fields(dest=secondary, source=mate_primary) # NB: calculate isize and proper pair as if this secondary alignment was the primary alignment. secondary.is_proper_pair = is_proper_pair(mate_primary, secondary) @@ -969,7 +954,7 @@ def set_mate_info_on_supplementary(supp: AlignedSegment, mate_primary: AlignedSe if not supp.is_supplementary: raise ValueError("Cannot set mate info on an alignment not marked as supplementary!") - _set_non_primary_mate_fields(secondary_or_supp=supp, mate_primary=mate_primary) + _set_common_mate_fields(dest=supp, source=mate_primary) # NB: for a non-secondary supplemental alignment, set the following to the same as the primary. if not supp.is_secondary: From 8baaa48cd9f0f0e06a59e3978c764837eb701750 Mon Sep 17 00:00:00 2001 From: clintval Date: Fri, 27 Dec 2024 17:00:50 -0500 Subject: [PATCH 25/36] chore: remove deprecated code --- fgpyo/sam/__init__.py | 32 -------------------------------- 1 file changed, 32 deletions(-) diff --git a/fgpyo/sam/__init__.py b/fgpyo/sam/__init__.py index 021a4fac..7a2c0b54 100644 --- a/fgpyo/sam/__init__.py +++ b/fgpyo/sam/__init__.py @@ -962,38 +962,6 @@ def set_mate_info_on_supplementary(supp: AlignedSegment, mate_primary: AlignedSe supp.template_length = -mate_primary.template_length -def set_as_pairs( - r1: AlignedSegment, - r2: AlignedSegment, - is_proper_pair: Callable[[AlignedSegment, AlignedSegment], bool] = is_proper_pair, -) -> None: - """Forces the two reads to become pairs as long as they share the same query name. - - This function will take two reads, as long as they have the same query name, and make them - pairs. The reads are marked as pairs and then first and second read flags are set. Finally, all - mate information is reset upon both reads. - - This function is useful for taking once-single-end reads and making them pairs. - - Args: - r1: Read 1 (first read in the template). - r2: Read 2 with the same query name as r1 (second read in the template). - is_proper_pair: A function that takes the two reads and determines proper pair status. - """ - if r1.query_name != r2.query_name: - raise ValueError("Cannot pair reads with different query names!") - - for r in [r1, r2]: - r.is_paired = True - - r1.is_read1 = True - r1.is_read2 = False - r2.is_read2 = True - r2.is_read1 = False - - set_mate_info(r1=r1, r2=r2, is_proper_pair=is_proper_pair) - - @deprecated("Use `set_mate_info()` instead. Deprecated after fgpyo 0.8.0.") def set_pair_info(r1: AlignedSegment, r2: AlignedSegment, proper_pair: bool = True) -> None: """Resets mate pair information between reads in a pair. From f95cc9ebcf3cf76b08ee4d5aebfca6aba92592ee Mon Sep 17 00:00:00 2001 From: clintval Date: Sat, 28 Dec 2024 09:56:24 -0500 Subject: [PATCH 26/36] feat: move the function only to Template --- fgpyo/sam/__init__.py | 55 ++++++++++++++++++++----------------------- 1 file changed, 25 insertions(+), 30 deletions(-) diff --git a/fgpyo/sam/__init__.py b/fgpyo/sam/__init__.py index 75cb73a2..e32e7dcc 100644 --- a/fgpyo/sam/__init__.py +++ b/fgpyo/sam/__init__.py @@ -178,6 +178,7 @@ from pysam import AlignedSegment from pysam import AlignmentFile as SamFile from pysam import AlignmentHeader as SamHeader +from typing_extensions import Self from typing_extensions import deprecated import fgpyo.io @@ -870,8 +871,8 @@ def _set_common_mate_fields(dest: AlignedSegment, source: AlignedSegment) -> Non dest: The alignment to set the mate info upon. source: The primary alignment to use as a mate reference. """ - if source.is_read1 is dest.is_read1 or source.is_secondary or source.is_supplementary: - raise ValueError("Mate info must be set from a primary of the next ordinal!") + if source.is_read1 is dest.is_read1 or source.is_supplementary: + raise ValueError("Mate info must be set from a primary or secondary of the next ordinal!") if source.query_name != dest.query_name: raise ValueError("Cannot set mate info on alignments with different query names!") @@ -1227,9 +1228,28 @@ def all_recs(self) -> Iterator[AlignedSegment]: for rec in recs: yield rec - def set_mate_info(self) -> "Template": - """Reset all mate information on every record in a template.""" - return set_mate_info_for_template(self) + def set_mate_info( + self, + is_proper_pair: Callable[[AlignedSegment, AlignedSegment], bool] = is_proper_pair, + ) -> Self: + """Reset all mate information on every record in the template. + + Args: + is_proper_pair: A function that takes two alignments and determines proper pair status. + """ + if self.r1 is not None and self.r2 is not None: + set_mate_info(self.r1, self.r2, is_proper_pair=is_proper_pair) + if self.r1 is not None: + for rec in self.r2_secondaries: + set_mate_info_on_secondary(rec, self.r1, is_proper_pair=is_proper_pair) + for rec in self.r2_supplementals: + set_mate_info_on_supplementary(rec, self.r1) + if self.r2 is not None: + for rec in self.r1_secondaries: + set_mate_info_on_secondary(rec, self.r2, is_proper_pair=is_proper_pair) + for rec in self.r1_supplementals: + set_mate_info_on_supplementary(rec, self.r2) + return self def write_to( self, @@ -1289,31 +1309,6 @@ def __next__(self) -> Template: return Template.build(recs, validate=False) -def set_mate_info_for_template( - template: Template, - is_proper_pair: Callable[[AlignedSegment, AlignedSegment], bool] = is_proper_pair, -) -> Template: - """Reset all mate information on every record in a template. - - Args: - template: The template of alignments to reset all mate information on. - is_proper_pair: A function that takes two alignments and determines proper pair status. - """ - if template.r1 is not None and template.r2 is not None: - set_mate_info(template.r1, template.r2, is_proper_pair=is_proper_pair) - if template.r1 is not None: - for rec in template.r2_secondaries: - set_mate_info_on_secondary(rec, template.r1, is_proper_pair=is_proper_pair) - for rec in template.r2_supplementals: - set_mate_info_on_supplementary(rec, template.r1) - if template.r2 is not None: - for rec in template.r1_secondaries: - set_mate_info_on_secondary(rec, template.r2, is_proper_pair=is_proper_pair) - for rec in template.r1_supplementals: - set_mate_info_on_supplementary(rec, template.r2) - return template - - class SamOrder(enum.Enum): """ Enumerations of possible sort orders for a SAM file. From 7c4a938a18bfb5d7ca6ff4132f54254b5b73a00c Mon Sep 17 00:00:00 2001 From: clintval Date: Sat, 28 Dec 2024 10:08:57 -0500 Subject: [PATCH 27/36] feat: better specify ValueErrors in funcs --- fgpyo/sam/__init__.py | 41 ++++++++++++++++++++++++++--------------- 1 file changed, 26 insertions(+), 15 deletions(-) diff --git a/fgpyo/sam/__init__.py b/fgpyo/sam/__init__.py index e32e7dcc..2176e140 100644 --- a/fgpyo/sam/__init__.py +++ b/fgpyo/sam/__init__.py @@ -870,9 +870,16 @@ def _set_common_mate_fields(dest: AlignedSegment, source: AlignedSegment) -> Non Args: dest: The alignment to set the mate info upon. source: The primary alignment to use as a mate reference. + + Raises: + ValueError: If dest and source are not of the same read ordinal. + ValueError: If source is supplementary (and not purely primary or secondary). + ValueError: If dest and source do not share the same query name. """ - if source.is_read1 is dest.is_read1 or source.is_supplementary: - raise ValueError("Mate info must be set from a primary or secondary of the next ordinal!") + if source.is_read1 is dest.is_read1: + raise ValueError("The two records must be of different read ordinals!") + if source.is_supplementary: + raise ValueError("Mate info must be set from a non-supplementary source!") if source.query_name != dest.query_name: raise ValueError("Cannot set mate info on alignments with different query names!") @@ -897,10 +904,12 @@ def set_mate_info( r1: Read 1 (first read in the template). r2: Read 2 with the same query name as r1 (second read in the template). is_proper_pair: A function that takes the two alignments and determines proper pair status. - """ - if r1.query_name != r2.query_name: - raise ValueError("Cannot set mate info on alignments with different query names!") + Raises: + ValueError: If r1 and r2 are not of the same read ordinal. + ValueError: If either r1 or r2 is supplementary (and not purely primary or secondary). + ValueError: If r1 and r2 do not share the same query name. + """ for dest, source in [(r1, r2), (r2, r1)]: _set_common_mate_fields(dest=dest, source=source) @@ -926,19 +935,18 @@ def set_mate_info_on_secondary( is_proper_pair: A function that takes the two alignments and determines proper pair status. Raises: - ValueError: If primary and secondary are of the same read ordinal. - ValueError: If the primary is marked as either secondary or supplementary. - ValueError: If the secondary is not marked as secondary. + ValueError: If secondary and mate_primary are not of the same read ordinal. + ValueError: If mate_primary is not purely a primary alignment. + ValueError: If secondary and mate_primary do not share the same query name. + ValueError: If secondary is not marked as a secondary alignment. """ + if mate_primary.is_secondary or mate_primary.is_supplementary: + raise ValueError("The mate primary must not be secondary or supplementary!") if not secondary.is_secondary: raise ValueError("Cannot set mate info on an alignment not marked as secondary!") _set_common_mate_fields(dest=secondary, source=mate_primary) - # NB: calculate isize and proper pair as if this secondary alignment was the primary alignment. - secondary.is_proper_pair = is_proper_pair(mate_primary, secondary) - secondary.template_length = isize(mate_primary, secondary) - def set_mate_info_on_supplementary(supp: AlignedSegment, mate_primary: AlignedSegment) -> None: """Set mate info on a supplementary alignment to its mate's primary alignment. @@ -948,10 +956,13 @@ def set_mate_info_on_supplementary(supp: AlignedSegment, mate_primary: AlignedSe mate_primary: The primary alignment of the supplementary's mate. Raises: - ValueError: If primary and secondary are of the same read ordinal. - ValueError: If the primary is marked as either secondary or supplementary. - ValueError: If the secondary is not marked as secondary. + ValueError: If supp and mate_primary are not of the same read ordinal. + ValueError: If mate_primary is not purely a primary alignment. + ValueError: If supp and mate_primary do not share the same query name. + ValueError: If supp is not marked as a supplementary alignment. """ + if mate_primary.is_secondary or mate_primary.is_supplementary: + raise ValueError("The mate primary must not be secondary or supplementary!") if not supp.is_supplementary: raise ValueError("Cannot set mate info on an alignment not marked as supplementary!") From 7a2ca2cf79d2154370b0f42c3c73c72ea650e2e7 Mon Sep 17 00:00:00 2001 From: clintval Date: Sat, 28 Dec 2024 10:15:07 -0500 Subject: [PATCH 28/36] chore: fixup docs a bit more --- fgpyo/sam/__init__.py | 46 +++++++++++++++++++++---------------------- 1 file changed, 23 insertions(+), 23 deletions(-) diff --git a/fgpyo/sam/__init__.py b/fgpyo/sam/__init__.py index 2176e140..aad2a867 100644 --- a/fgpyo/sam/__init__.py +++ b/fgpyo/sam/__init__.py @@ -865,11 +865,11 @@ def sum_of_base_qualities(rec: AlignedSegment, min_quality_score: int = 15) -> i def _set_common_mate_fields(dest: AlignedSegment, source: AlignedSegment) -> None: - """Set common mate info an alignment to its mate's primary alignment. + """Set common mate info on a destination alignment to its mate's primary alignment (source). Args: dest: The alignment to set the mate info upon. - source: The primary alignment to use as a mate reference. + source: The alignment to use as a mate reference. Raises: ValueError: If dest and source are not of the same read ordinal. @@ -877,7 +877,7 @@ def _set_common_mate_fields(dest: AlignedSegment, source: AlignedSegment) -> Non ValueError: If dest and source do not share the same query name. """ if source.is_read1 is dest.is_read1: - raise ValueError("The two records must be of different read ordinals!") + raise ValueError("source and dest records must be of different read ordinals!") if source.is_supplementary: raise ValueError("Mate info must be set from a non-supplementary source!") if source.query_name != dest.query_name: @@ -894,50 +894,50 @@ def _set_common_mate_fields(dest: AlignedSegment, source: AlignedSegment) -> Non def set_mate_info( - r1: AlignedSegment, - r2: AlignedSegment, + rec1: AlignedSegment, + rec2: AlignedSegment, is_proper_pair: Callable[[AlignedSegment, AlignedSegment], bool] = is_proper_pair, + isize: Callable[[AlignedSegment, AlignedSegment], int] = isize, ) -> None: """Resets mate pair information between reads in a pair. Args: - r1: Read 1 (first read in the template). - r2: Read 2 with the same query name as r1 (second read in the template). + rec1: The first record in the pair. + rec2: The second record in the pair. is_proper_pair: A function that takes the two alignments and determines proper pair status. + isize: A function that takes the two alignments and calculates their isize. Raises: - ValueError: If r1 and r2 are not of the same read ordinal. - ValueError: If either r1 or r2 is supplementary (and not purely primary or secondary). - ValueError: If r1 and r2 do not share the same query name. + ValueError: If rec1 and rec2 are of the same read ordinal. + ValueError: If either rec1 or rec2 is supplementary (and not purely primary or secondary). + ValueError: If rec1 and rec2 do not share the same query name. """ - for dest, source in [(r1, r2), (r2, r1)]: + for dest, source in [(rec1, rec2), (rec2, rec1)]: _set_common_mate_fields(dest=dest, source=source) - template_length = isize(r1, r2) - r1.template_length = template_length - r2.template_length = -template_length + template_length = isize(rec1, rec2) + rec1.template_length = template_length + rec2.template_length = -template_length - proper_pair = is_proper_pair(r1, r2) - r1.is_proper_pair = proper_pair - r2.is_proper_pair = proper_pair + proper_pair = is_proper_pair(rec1, rec2) + rec1.is_proper_pair = proper_pair + rec2.is_proper_pair = proper_pair def set_mate_info_on_secondary( secondary: AlignedSegment, mate_primary: AlignedSegment, - is_proper_pair: Callable[[AlignedSegment, AlignedSegment], bool] = is_proper_pair, ) -> None: """Set mate info on a secondary alignment to its mate's primary alignment. Args: secondary: The secondary alignment to set mate information upon. mate_primary: The primary alignment of the secondary's mate. - is_proper_pair: A function that takes the two alignments and determines proper pair status. Raises: - ValueError: If secondary and mate_primary are not of the same read ordinal. - ValueError: If mate_primary is not purely a primary alignment. + ValueError: If secondary and mate_primary are of the same read ordinal. ValueError: If secondary and mate_primary do not share the same query name. + ValueError: If mate_primary is not purely a primary alignment. ValueError: If secondary is not marked as a secondary alignment. """ if mate_primary.is_secondary or mate_primary.is_supplementary: @@ -956,9 +956,9 @@ def set_mate_info_on_supplementary(supp: AlignedSegment, mate_primary: AlignedSe mate_primary: The primary alignment of the supplementary's mate. Raises: - ValueError: If supp and mate_primary are not of the same read ordinal. - ValueError: If mate_primary is not purely a primary alignment. + ValueError: If supp and mate_primary are of the same read ordinal. ValueError: If supp and mate_primary do not share the same query name. + ValueError: If mate_primary is not purely a primary alignment. ValueError: If supp is not marked as a supplementary alignment. """ if mate_primary.is_secondary or mate_primary.is_supplementary: From dd7dba5b51c57d8f88bbc66438c871815a88b6da Mon Sep 17 00:00:00 2001 From: clintval Date: Sat, 28 Dec 2024 10:15:54 -0500 Subject: [PATCH 29/36] chore: fixup docs even more --- fgpyo/sam/__init__.py | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/fgpyo/sam/__init__.py b/fgpyo/sam/__init__.py index aad2a867..060d1f6f 100644 --- a/fgpyo/sam/__init__.py +++ b/fgpyo/sam/__init__.py @@ -865,7 +865,7 @@ def sum_of_base_qualities(rec: AlignedSegment, min_quality_score: int = 15) -> i def _set_common_mate_fields(dest: AlignedSegment, source: AlignedSegment) -> None: - """Set common mate info on a destination alignment to its mate's primary alignment (source). + """Set common mate info on a destination alignment to its mate's non-supplementary alignment. Args: dest: The alignment to set the mate info upon. From 841a44adb5fb05b1c5b769f88404f43250002b29 Mon Sep 17 00:00:00 2001 From: clintval Date: Sat, 28 Dec 2024 10:21:24 -0500 Subject: [PATCH 30/36] fix: fixup remaining remaining loose ends --- fgpyo/sam/__init__.py | 19 +++++++++---------- 1 file changed, 9 insertions(+), 10 deletions(-) diff --git a/fgpyo/sam/__init__.py b/fgpyo/sam/__init__.py index 060d1f6f..f55933ee 100644 --- a/fgpyo/sam/__init__.py +++ b/fgpyo/sam/__init__.py @@ -924,10 +924,7 @@ def set_mate_info( rec2.is_proper_pair = proper_pair -def set_mate_info_on_secondary( - secondary: AlignedSegment, - mate_primary: AlignedSegment, -) -> None: +def set_mate_info_on_secondary(secondary: AlignedSegment, mate_primary: AlignedSegment) -> None: """Set mate info on a secondary alignment to its mate's primary alignment. Args: @@ -997,7 +994,7 @@ def set_pair_info(r1: AlignedSegment, r2: AlignedSegment, proper_pair: bool = Tr r2.is_read2 = True r2.is_read1 = False - set_mate_info(r1=r1, r2=r2, is_proper_pair=lambda a, b: proper_pair) + set_mate_info(rec1=r1, rec2=r2, is_proper_pair=lambda a, b: proper_pair) @attr.s(frozen=True, auto_attribs=True) @@ -1242,24 +1239,26 @@ def all_recs(self) -> Iterator[AlignedSegment]: def set_mate_info( self, is_proper_pair: Callable[[AlignedSegment, AlignedSegment], bool] = is_proper_pair, + isize: Callable[[AlignedSegment, AlignedSegment], int] = isize, ) -> Self: """Reset all mate information on every record in the template. Args: is_proper_pair: A function that takes two alignments and determines proper pair status. + isize: A function that takes the two alignments and calculates their isize. """ if self.r1 is not None and self.r2 is not None: - set_mate_info(self.r1, self.r2, is_proper_pair=is_proper_pair) + set_mate_info(self.r1, self.r2, is_proper_pair=is_proper_pair, isize=isize) if self.r1 is not None: for rec in self.r2_secondaries: - set_mate_info_on_secondary(rec, self.r1, is_proper_pair=is_proper_pair) + set_mate_info_on_secondary(secondary=rec, mate_primary=self.r1) for rec in self.r2_supplementals: - set_mate_info_on_supplementary(rec, self.r1) + set_mate_info_on_supplementary(supp=rec, mate_primary=self.r1) if self.r2 is not None: for rec in self.r1_secondaries: - set_mate_info_on_secondary(rec, self.r2, is_proper_pair=is_proper_pair) + set_mate_info_on_secondary(secondary=rec, mate_primary=self.r2) for rec in self.r1_supplementals: - set_mate_info_on_supplementary(rec, self.r2) + set_mate_info_on_supplementary(supp=rec, mate_primary=self.r2) return self def write_to( From 714006336218b262919993ace5a3c5cb5fa88a0b Mon Sep 17 00:00:00 2001 From: clintval Date: Mon, 30 Dec 2024 09:45:16 -0500 Subject: [PATCH 31/36] chore: finish adding unit tests --- tests/fgpyo/sam/test_sam.py | 228 +++++++++++++++++++++++++++++++++++- 1 file changed, 225 insertions(+), 3 deletions(-) diff --git a/tests/fgpyo/sam/test_sam.py b/tests/fgpyo/sam/test_sam.py index e822ee51..24a263f9 100755 --- a/tests/fgpyo/sam/test_sam.py +++ b/tests/fgpyo/sam/test_sam.py @@ -21,6 +21,9 @@ from fgpyo.sam import SamFileType from fgpyo.sam import is_proper_pair from fgpyo.sam import set_mate_info +from fgpyo.sam import set_mate_info_on_secondary +from fgpyo.sam import set_mate_info_on_supplementary +from fgpyo.sam import set_pair_info from fgpyo.sam import sum_of_base_qualities from fgpyo.sam.builder import SamBuilder @@ -683,12 +686,32 @@ def test_calc_edit_info_with_aligned_Ns() -> None: assert info.nm == 5 +def test_set_mate_info_raises_not_opposite_read_ordinals() -> None: + """Test set_mate_info raises an exception for mismatched read ordinals.""" + builder = SamBuilder() + r1 = builder.add_single(name="x", read_num=1) + r2 = builder.add_single(name="x", read_num=1) + with pytest.raises( + ValueError, match="source and dest records must be of different read ordinals!" + ): + set_mate_info(r1, r2) + + +def test_set_mate_info_raises_when_second_rec_is_supplementary() -> None: + """Test set_mate_info raises an exception when the second record is supplementary.""" + builder = SamBuilder() + r1 = builder.add_single(name="x", read_num=1) + r2 = builder.add_single(name="x", read_num=2) + r2.is_supplementary = True + with pytest.raises(ValueError, match="Mate info must be set from a non-supplementary source!"): + set_mate_info(r1, r2) + + def test_set_mate_info_raises_mimatched_query_names() -> None: """Test set_mate_info raises an exception for mismatched query names.""" builder = SamBuilder() - r1 = builder.add_single(read_num=1) - r2 = builder.add_single(read_num=2) - assert r1.query_name != r2.query_name + r1 = builder.add_single(name="x", read_num=1) + r2 = builder.add_single(name="y", read_num=2) with pytest.raises( ValueError, match="Cannot set mate info on alignments with different query names!" ): @@ -804,3 +827,202 @@ def test_set_mate_info_both_mapped() -> None: assert r2.is_reverse is True assert r1.mate_is_reverse is True assert r2.mate_is_forward is True + + +def test_set_mate_info_on_secondary() -> None: + """Test set_mate_info_on_secondary sets mate info for a secondary record.""" + builder = SamBuilder() + secondary, primary = builder.add_pair() + secondary.is_secondary = True + + assert secondary.is_unmapped is True + assert primary.is_unmapped is True + + set_mate_info_on_secondary(secondary, primary) + + assert secondary.reference_id == sam.NO_REF_INDEX + assert secondary.reference_name is None + assert secondary.reference_start == sam.NO_REF_POS + assert secondary.next_reference_id == sam.NO_REF_INDEX + assert secondary.next_reference_name is None + assert secondary.next_reference_start == sam.NO_REF_POS + assert not secondary.has_tag("MC") + assert secondary.has_tag("MQ") + assert secondary.get_tag("MQ") == 0 + assert secondary.has_tag("ms") + assert secondary.get_tag("ms") == 3000 + assert secondary.template_length == 0 + assert secondary.is_proper_pair is False + + # NB: unmapped records are forward until proven otherwise + assert secondary.is_forward is True + assert secondary.mate_is_forward is True + + +def test_set_mate_info_on_secondary_raises_for_secondary_or_supp_rec2() -> None: + """Test that set_mate_info_on_secondary raises an exception if rec2 is secondary or supp.""" + builder = SamBuilder() + r1 = builder.add_single(name="x", read_num=1) + r2 = builder.add_single(name="x", read_num=2) + r2.is_secondary = True + with pytest.raises( + ValueError, match="The mate primary must not be secondary or supplementary!" + ): + set_mate_info_on_secondary(r1, r2) + r2.is_secondary = False + r2.is_supplementary = True + with pytest.raises( + ValueError, match="The mate primary must not be secondary or supplementary!" + ): + set_mate_info_on_secondary(r1, r2) + + +def test_set_mate_info_on_secondary_raises_for_non_secondary_rec1() -> None: + """Test that set_mate_info_on_secondary raises an exception if rec1 is not secondary.""" + builder = SamBuilder() + r1 = builder.add_single(name="x", read_num=1) + r2 = builder.add_single(name="x", read_num=2) + with pytest.raises( + ValueError, match="Cannot set mate info on an alignment not marked as secondary!" + ): + set_mate_info_on_secondary(r1, r2) + + +def test_set_mate_info_on_supplementary() -> None: + """Test set_mate_info_on_supplementary sets mate info for a supplementary record.""" + builder = SamBuilder() + supplementary, primary = builder.add_pair() + supplementary.is_supplementary = True + + assert supplementary.is_unmapped is True + assert primary.is_unmapped is True + + set_mate_info_on_supplementary(supplementary, primary) + + assert supplementary.reference_id == sam.NO_REF_INDEX + assert supplementary.reference_name is None + assert supplementary.reference_start == sam.NO_REF_POS + assert supplementary.next_reference_id == sam.NO_REF_INDEX + assert supplementary.next_reference_name is None + assert supplementary.next_reference_start == sam.NO_REF_POS + assert not supplementary.has_tag("MC") + assert supplementary.has_tag("MQ") + assert supplementary.get_tag("MQ") == 0 + assert supplementary.has_tag("ms") + assert supplementary.get_tag("ms") == 3000 + assert supplementary.template_length == 0 + assert supplementary.is_proper_pair is False + + # NB: unmapped records are forward until proven otherwise + assert supplementary.is_forward is True + assert supplementary.mate_is_forward is True + + +def test_set_mate_info_on_supplementary_raises_for_secondary_or_supp_rec2() -> None: + """Test that set_mate_info_on_supplementary raises an exception if rec2 is secondary or supp.""" + builder = SamBuilder() + r1 = builder.add_single(name="x", read_num=1) + r2 = builder.add_single(name="x", read_num=2) + r2.is_secondary = True + with pytest.raises( + ValueError, match="The mate primary must not be secondary or supplementary!" + ): + set_mate_info_on_supplementary(r1, r2) + r2.is_secondary = False + r2.is_supplementary = True + with pytest.raises( + ValueError, match="The mate primary must not be secondary or supplementary!" + ): + set_mate_info_on_supplementary(r1, r2) + + +def test_set_mate_info_on_supplementary_raises_for_non_secondary_rec1() -> None: + """Test that set_mate_info_on_supplementary raises an exception if rec1 is not supplementary.""" + builder = SamBuilder() + r1 = builder.add_single(name="x", read_num=1) + r2 = builder.add_single(name="x", read_num=2) + with pytest.raises( + ValueError, match="Cannot set mate info on an alignment not marked as supplementary!" + ): + set_mate_info_on_supplementary(r1, r2) + + +def test_set_mate_info_on_supplementary_sets_additional_fields_for_primary_supplemental() -> None: + """Tests that set_mate_info_on_supplementary sets additional fields for primary supplements.""" + builder = SamBuilder() + r1 = builder.add_single(name="x", read_num=1) + r2 = builder.add_single(name="x", read_num=2) + r1.is_supplementary = True + r2.is_proper_pair = True + r2.template_length = 100 + + assert not r1.is_proper_pair + assert r1.template_length == 0 + set_mate_info_on_supplementary(r1, r2) + assert r1.is_proper_pair + assert r1.template_length == -100 + + +def test_set_mate_info_on_supplementary_does_not_set_fields_for_secondary_supplemental() -> None: + """Tests that set_mate_info_on_supplementary does not set fields for secondary supplements.""" + builder = SamBuilder() + r1 = builder.add_single(name="x", read_num=1) + r2 = builder.add_single(name="x", read_num=2) + r1.is_secondary = True + r1.is_supplementary = True + r2.is_proper_pair = True + r2.template_length = 100 + + assert not r1.is_proper_pair + assert r1.template_length == 0 + set_mate_info_on_supplementary(r1, r2) + assert not r1.is_proper_pair + assert r1.template_length == 0 + + +@pytest.mark.filterwarnings("ignore::DeprecationWarning") +def test_set_pair_info_raises_exception_for_mismatched_query_names() -> None: + """Test that set_pair_info raises an exception for mismatched query names.""" + builder = SamBuilder() + r1 = builder.add_single(name="x", read_num=1) + r2 = builder.add_single(name="y", read_num=2) + with pytest.raises( + ValueError, + match="Cannot set pair info on reads with different query names!", + ): + set_pair_info(r1, r2) + + +@pytest.mark.filterwarnings("ignore::DeprecationWarning") +def test_set_pair_info_both_mapped() -> None: + """Test set_pair_info sets mate info for two mapped records.""" + builder = SamBuilder() + r1, r2 = builder.add_pair(chrom="chr1", start1=200, start2=300) + assert r1.is_mapped is True + assert r2.is_mapped is True + + set_pair_info(r1, r2, proper_pair=False) + + for rec in (r1, r2): + assert rec.reference_id == builder.header.get_tid("chr1") + assert rec.reference_name == "chr1" + assert rec.next_reference_id == builder.header.get_tid("chr1") + assert rec.next_reference_name == "chr1" + assert rec.has_tag("MC") + assert rec.get_tag("MC") == "100M" + assert rec.has_tag("MQ") + assert rec.get_tag("MQ") == 60 + assert rec.has_tag("ms") + assert rec.get_tag("ms") == 3000 + assert rec.is_proper_pair is False + + assert r1.reference_start == 200 + assert r1.next_reference_start == 300 + assert r2.reference_start == 300 + assert r2.next_reference_start == 200 + assert r1.template_length == 200 + assert r2.template_length == -200 + assert r1.is_forward is True + assert r2.is_reverse is True + assert r1.mate_is_reverse is True + assert r2.mate_is_forward is True From 4f2fbea125ac4b00e51b667bfc283c1875c49178 Mon Sep 17 00:00:00 2001 From: clintval Date: Mon, 30 Dec 2024 09:47:33 -0500 Subject: [PATCH 32/36] docs: fix docstring typo --- fgpyo/sam/__init__.py | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/fgpyo/sam/__init__.py b/fgpyo/sam/__init__.py index f55933ee..a191b2d7 100644 --- a/fgpyo/sam/__init__.py +++ b/fgpyo/sam/__init__.py @@ -872,7 +872,7 @@ def _set_common_mate_fields(dest: AlignedSegment, source: AlignedSegment) -> Non source: The alignment to use as a mate reference. Raises: - ValueError: If dest and source are not of the same read ordinal. + ValueError: If dest and source are of the same read ordinal. ValueError: If source is supplementary (and not purely primary or secondary). ValueError: If dest and source do not share the same query name. """ From ec56350fd9e89fb3c02a9c91d960ce79889f5a53 Mon Sep 17 00:00:00 2001 From: clintval Date: Mon, 30 Dec 2024 10:29:04 -0500 Subject: [PATCH 33/36] chore: add unit tests for Template.set_mate_info() --- tests/fgpyo/sam/test_sam.py | 4 +- tests/fgpyo/sam/test_template_iterator.py | 168 ++++++++++++++++++++++ 2 files changed, 170 insertions(+), 2 deletions(-) diff --git a/tests/fgpyo/sam/test_sam.py b/tests/fgpyo/sam/test_sam.py index 24a263f9..967ade61 100755 --- a/tests/fgpyo/sam/test_sam.py +++ b/tests/fgpyo/sam/test_sam.py @@ -956,11 +956,11 @@ def test_set_mate_info_on_supplementary_sets_additional_fields_for_primary_suppl r2.is_proper_pair = True r2.template_length = 100 - assert not r1.is_proper_pair + assert r1.is_proper_pair is False assert r1.template_length == 0 set_mate_info_on_supplementary(r1, r2) - assert r1.is_proper_pair assert r1.template_length == -100 + assert r1.is_proper_pair is True def test_set_mate_info_on_supplementary_does_not_set_fields_for_secondary_supplemental() -> None: diff --git a/tests/fgpyo/sam/test_template_iterator.py b/tests/fgpyo/sam/test_template_iterator.py index d2f44f7a..b500032a 100644 --- a/tests/fgpyo/sam/test_template_iterator.py +++ b/tests/fgpyo/sam/test_template_iterator.py @@ -219,3 +219,171 @@ def test_set_tag() -> None: for bad_tag in ["", "A", "ABC", "ABCD"]: with pytest.raises(AssertionError, match="Tags must be 2 characters"): template.set_tag(bad_tag, VALUE) + + +def test_template_set_mate_info() -> None: + """Test that Template set_mate_info fixes up all records in a template.""" + builder = SamBuilder() + + r1, r2 = builder.add_pair(name="x", chrom="chr1", start1=200, start2=300) + r1_secondary = builder.add_single(name="x", read_num=1, chrom="chr1", start=2) + r2_secondary = builder.add_single(name="x", read_num=2, chrom="chr1", start=5) + r1_secondary.is_secondary = True + r2_secondary.is_secondary = True + + r1_supp = builder.add_single(name="x", read_num=1, chrom="chr1", start=4) + r2_supp = builder.add_single(name="x", read_num=2, chrom="chr1", start=5) + r1_supp.is_supplementary = True + r2_supp.is_supplementary = True + + r1_secondary_supp = builder.add_single(name="x", read_num=1, chrom="chr1", start=6) + r2_secondary_supp = builder.add_single(name="x", read_num=2, chrom="chr1", start=7) + r1_secondary_supp.is_secondary = True + r2_secondary_supp.is_secondary = True + r1_secondary_supp.is_supplementary = True + r2_secondary_supp.is_supplementary = True + + template = Template.build( + [ + r1, + r2, + r1_secondary, + r2_secondary, + r1_supp, + r2_supp, + r1_secondary_supp, + r2_secondary_supp, + ] + ) + + template.set_mate_info() + + # Assert the state of both the R1 and R2 alignments + for rec in (template.r1, template.r2): + assert rec.reference_id == builder.header.get_tid("chr1") + assert rec.reference_name == "chr1" + assert rec.next_reference_id == builder.header.get_tid("chr1") + assert rec.next_reference_name == "chr1" + assert rec.has_tag("MC") + assert rec.get_tag("MC") == "100M" + assert rec.has_tag("MQ") + assert rec.get_tag("MQ") == 60 + assert rec.has_tag("ms") + assert rec.get_tag("ms") == 3000 + assert rec.is_proper_pair is True + + assert template.r1.reference_start == 200 + assert template.r1.next_reference_start == 300 + assert template.r2.reference_start == 300 + assert template.r2.next_reference_start == 200 + assert template.r1.template_length == 200 + assert template.r2.template_length == -200 + assert template.r1.is_forward is True + assert template.r2.is_reverse is True + assert template.r1.mate_is_reverse is True + assert template.r2.mate_is_forward is True + + # Assert the state of the two secondary non-supplementary alignments + assert template.r1_secondaries[0].reference_id == builder.header.get_tid("chr1") + assert template.r1_secondaries[0].reference_name == "chr1" + assert template.r1_secondaries[0].reference_start == 2 + assert template.r1_secondaries[0].next_reference_id == template.r2.reference_id + assert template.r1_secondaries[0].next_reference_name == template.r2.reference_name + assert template.r1_secondaries[0].next_reference_start == template.r2.reference_start + assert template.r1_secondaries[0].has_tag("MC") + assert template.r1_secondaries[0].get_tag("MC") == template.r2.cigarstring + assert template.r1_secondaries[0].has_tag("MQ") + assert template.r1_secondaries[0].get_tag("MQ") == template.r2.mapping_quality + assert template.r1_secondaries[0].has_tag("ms") + assert template.r1_secondaries[0].get_tag("ms") == 3000 + assert template.r1_secondaries[0].template_length == 0 + assert template.r1_secondaries[0].is_proper_pair is False + assert template.r1_secondaries[0].is_forward is True + assert template.r1_secondaries[0].mate_is_forward is template.r2.is_forward + + assert template.r2_secondaries[0].reference_id == builder.header.get_tid("chr1") + assert template.r2_secondaries[0].reference_name == "chr1" + assert template.r2_secondaries[0].reference_start == 5 + assert template.r2_secondaries[0].next_reference_id == template.r1.reference_id + assert template.r2_secondaries[0].next_reference_name == template.r1.reference_name + assert template.r2_secondaries[0].next_reference_start == template.r1.reference_start + assert template.r2_secondaries[0].has_tag("MC") + assert template.r2_secondaries[0].get_tag("MC") == template.r1.cigarstring + assert template.r2_secondaries[0].has_tag("MQ") + assert template.r2_secondaries[0].get_tag("MQ") == template.r1.mapping_quality + assert template.r2_secondaries[0].has_tag("ms") + assert template.r2_secondaries[0].get_tag("ms") == 3000 + assert template.r2_secondaries[0].template_length == 0 + assert template.r2_secondaries[0].is_proper_pair is False + assert template.r2_secondaries[0].is_forward is True + assert template.r2_secondaries[0].mate_is_forward is template.r1.is_forward + + # Assert the state of the two non-secondary supplemental alignments + assert template.r1_supplementals[0].reference_id == builder.header.get_tid("chr1") + assert template.r1_supplementals[0].reference_name == "chr1" + assert template.r1_supplementals[0].reference_start == 4 + assert template.r1_supplementals[0].next_reference_id == template.r2.reference_id + assert template.r1_supplementals[0].next_reference_name == template.r2.reference_name + assert template.r1_supplementals[0].next_reference_start == template.r2.reference_start + assert template.r1_supplementals[0].has_tag("MC") + assert template.r1_supplementals[0].get_tag("MC") == template.r2.cigarstring + assert template.r1_supplementals[0].has_tag("MQ") + assert template.r1_supplementals[0].get_tag("MQ") == template.r2.mapping_quality + assert template.r1_supplementals[0].has_tag("ms") + assert template.r1_supplementals[0].get_tag("ms") == 3000 + assert template.r1_supplementals[0].template_length == 200 + assert template.r1_supplementals[0].is_proper_pair is True + assert template.r1_supplementals[0].is_forward is True + assert template.r1_supplementals[0].mate_is_forward is template.r2.is_forward + + assert template.r2_supplementals[0].reference_id == builder.header.get_tid("chr1") + assert template.r2_supplementals[0].reference_name == "chr1" + assert template.r2_supplementals[0].reference_start == 5 + assert template.r2_supplementals[0].next_reference_id == template.r1.reference_id + assert template.r2_supplementals[0].next_reference_name == template.r1.reference_name + assert template.r2_supplementals[0].next_reference_start == template.r1.reference_start + assert template.r2_supplementals[0].has_tag("MC") + assert template.r2_supplementals[0].get_tag("MC") == template.r1.cigarstring + assert template.r2_supplementals[0].has_tag("MQ") + assert template.r2_supplementals[0].get_tag("MQ") == template.r1.mapping_quality + assert template.r2_supplementals[0].has_tag("ms") + assert template.r2_supplementals[0].get_tag("ms") == 3000 + assert template.r2_supplementals[0].template_length == -200 + assert template.r2_supplementals[0].is_proper_pair is True + assert template.r2_supplementals[0].is_forward is True + assert template.r2_supplementals[0].mate_is_forward is template.r1.is_forward + + # Assert the state of the two secondary supplemental alignments + assert template.r1_supplementals[1].reference_id == builder.header.get_tid("chr1") + assert template.r1_supplementals[1].reference_name == "chr1" + assert template.r1_supplementals[1].reference_start == 6 + assert template.r1_supplementals[1].next_reference_id == template.r2.reference_id + assert template.r1_supplementals[1].next_reference_name == template.r2.reference_name + assert template.r1_supplementals[1].next_reference_start == template.r2.reference_start + assert template.r1_supplementals[1].has_tag("MC") + assert template.r1_supplementals[1].get_tag("MC") == template.r2.cigarstring + assert template.r1_supplementals[1].has_tag("MQ") + assert template.r1_supplementals[1].get_tag("MQ") == template.r2.mapping_quality + assert template.r1_supplementals[1].has_tag("ms") + assert template.r1_supplementals[1].get_tag("ms") == 3000 + assert template.r1_supplementals[1].template_length == 0 + assert template.r1_supplementals[1].is_proper_pair is False + assert template.r1_supplementals[1].is_forward is True + assert template.r1_supplementals[1].mate_is_forward is template.r2.is_forward + + assert template.r2_supplementals[1].reference_id == builder.header.get_tid("chr1") + assert template.r2_supplementals[1].reference_name == "chr1" + assert template.r2_supplementals[1].reference_start == 7 + assert template.r2_supplementals[1].next_reference_id == template.r1.reference_id + assert template.r2_supplementals[1].next_reference_name == template.r1.reference_name + assert template.r2_supplementals[1].next_reference_start == template.r1.reference_start + assert template.r2_supplementals[1].has_tag("MC") + assert template.r2_supplementals[1].get_tag("MC") == template.r1.cigarstring + assert template.r2_supplementals[1].has_tag("MQ") + assert template.r2_supplementals[1].get_tag("MQ") == template.r1.mapping_quality + assert template.r2_supplementals[1].has_tag("ms") + assert template.r2_supplementals[1].get_tag("ms") == 3000 + assert template.r2_supplementals[1].template_length == 0 + assert template.r2_supplementals[1].is_proper_pair is False + assert template.r2_supplementals[1].is_forward is True + assert template.r2_supplementals[1].mate_is_forward is template.r1.is_forward From 7116964026e096b531cb9036d959744d5019c472 Mon Sep 17 00:00:00 2001 From: clintval Date: Mon, 30 Dec 2024 10:38:38 -0500 Subject: [PATCH 34/36] chore: fix test typo --- tests/fgpyo/sam/test_sam.py | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/tests/fgpyo/sam/test_sam.py b/tests/fgpyo/sam/test_sam.py index 967ade61..10cc5da8 100755 --- a/tests/fgpyo/sam/test_sam.py +++ b/tests/fgpyo/sam/test_sam.py @@ -707,7 +707,7 @@ def test_set_mate_info_raises_when_second_rec_is_supplementary() -> None: set_mate_info(r1, r2) -def test_set_mate_info_raises_mimatched_query_names() -> None: +def test_set_mate_info_raises_mismatched_query_names() -> None: """Test set_mate_info raises an exception for mismatched query names.""" builder = SamBuilder() r1 = builder.add_single(name="x", read_num=1) From 716de7975a92d2e93fd6b719eeb7dd6ee6ea85e8 Mon Sep 17 00:00:00 2001 From: clintval Date: Tue, 7 Jan 2025 09:29:15 -0500 Subject: [PATCH 35/36] chore: tweak phrasing in docstrings slightly --- fgpyo/sam/__init__.py | 12 ++++++------ 1 file changed, 6 insertions(+), 6 deletions(-) diff --git a/fgpyo/sam/__init__.py b/fgpyo/sam/__init__.py index a191b2d7..5c845404 100644 --- a/fgpyo/sam/__init__.py +++ b/fgpyo/sam/__init__.py @@ -865,11 +865,11 @@ def sum_of_base_qualities(rec: AlignedSegment, min_quality_score: int = 15) -> i def _set_common_mate_fields(dest: AlignedSegment, source: AlignedSegment) -> None: - """Set common mate info on a destination alignment to its mate's non-supplementary alignment. + """Set common mate info on a destination alignment from its mate's non-supplementary alignment. Args: dest: The alignment to set the mate info upon. - source: The alignment to use as a mate reference. + source: The non-supplementary alignment to use as a mate reference. Raises: ValueError: If dest and source are of the same read ordinal. @@ -899,7 +899,7 @@ def set_mate_info( is_proper_pair: Callable[[AlignedSegment, AlignedSegment], bool] = is_proper_pair, isize: Callable[[AlignedSegment, AlignedSegment], int] = isize, ) -> None: - """Resets mate pair information between reads in a pair. + """Resets mate pair information between two records that share a query name. Args: rec1: The first record in the pair. @@ -925,7 +925,7 @@ def set_mate_info( def set_mate_info_on_secondary(secondary: AlignedSegment, mate_primary: AlignedSegment) -> None: - """Set mate info on a secondary alignment to its mate's primary alignment. + """Set mate info on a secondary alignment from its mate's primary alignment. Args: secondary: The secondary alignment to set mate information upon. @@ -946,7 +946,7 @@ def set_mate_info_on_secondary(secondary: AlignedSegment, mate_primary: AlignedS def set_mate_info_on_supplementary(supp: AlignedSegment, mate_primary: AlignedSegment) -> None: - """Set mate info on a supplementary alignment to its mate's primary alignment. + """Set mate info on a supplementary alignment from its mate's primary alignment. Args: supp: The supplementary alignment to set mate information upon. @@ -1241,7 +1241,7 @@ def set_mate_info( is_proper_pair: Callable[[AlignedSegment, AlignedSegment], bool] = is_proper_pair, isize: Callable[[AlignedSegment, AlignedSegment], int] = isize, ) -> Self: - """Reset all mate information on every record in the template. + """Reset all mate information on every alignment in the template. Args: is_proper_pair: A function that takes two alignments and determines proper pair status. From 0649c675cce515f2dfbe2aeadf89616b6b5208dd Mon Sep 17 00:00:00 2001 From: clintval Date: Fri, 10 Jan 2025 08:44:02 -0500 Subject: [PATCH 36/36] feat: mate info can only come from a primary record --- fgpyo/sam/__init__.py | 56 +++++++++++++++++-------------------- tests/fgpyo/sam/test_sam.py | 16 +++++++---- 2 files changed, 36 insertions(+), 36 deletions(-) diff --git a/fgpyo/sam/__init__.py b/fgpyo/sam/__init__.py index 5c845404..a96d14e5 100644 --- a/fgpyo/sam/__init__.py +++ b/fgpyo/sam/__init__.py @@ -864,33 +864,33 @@ def sum_of_base_qualities(rec: AlignedSegment, min_quality_score: int = 15) -> i return score -def _set_common_mate_fields(dest: AlignedSegment, source: AlignedSegment) -> None: - """Set common mate info on a destination alignment from its mate's non-supplementary alignment. +def _set_common_mate_fields(dest: AlignedSegment, mate_primary: AlignedSegment) -> None: + """Set common mate info on a destination alignment from its mate's primary alignment. Args: dest: The alignment to set the mate info upon. - source: The non-supplementary alignment to use as a mate reference. + mate_primary: The primary alignment to use as a mate reference. Raises: - ValueError: If dest and source are of the same read ordinal. - ValueError: If source is supplementary (and not purely primary or secondary). - ValueError: If dest and source do not share the same query name. + ValueError: If dest and mate_primary are of the same read ordinal. + ValueError: If mate_primary is secondary or supplementary. + ValueError: If dest and mate_primary do not share the same query name. """ - if source.is_read1 is dest.is_read1: - raise ValueError("source and dest records must be of different read ordinals!") - if source.is_supplementary: - raise ValueError("Mate info must be set from a non-supplementary source!") - if source.query_name != dest.query_name: + if mate_primary.is_read1 is dest.is_read1: + raise ValueError("mate_primary and dest records must be of different read ordinals!") + if mate_primary.is_supplementary or mate_primary.is_secondary: + raise ValueError("Mate info must be set from a non-supplementary non-secondary record!") + if mate_primary.query_name != dest.query_name: raise ValueError("Cannot set mate info on alignments with different query names!") - dest.next_reference_id = source.reference_id - dest.next_reference_name = source.reference_name - dest.next_reference_start = source.reference_start - dest.mate_is_forward = source.is_forward - dest.mate_is_mapped = source.is_mapped - dest.set_tag("MC", source.cigarstring) - dest.set_tag("MQ", source.mapping_quality) - dest.set_tag("ms", sum_of_base_qualities(source)) + dest.next_reference_id = mate_primary.reference_id + dest.next_reference_name = mate_primary.reference_name + dest.next_reference_start = mate_primary.reference_start + dest.mate_is_forward = mate_primary.is_forward + dest.mate_is_mapped = mate_primary.is_mapped + dest.set_tag("MC", mate_primary.cigarstring) + dest.set_tag("MQ", mate_primary.mapping_quality) + dest.set_tag("ms", sum_of_base_qualities(mate_primary)) def set_mate_info( @@ -899,7 +899,7 @@ def set_mate_info( is_proper_pair: Callable[[AlignedSegment, AlignedSegment], bool] = is_proper_pair, isize: Callable[[AlignedSegment, AlignedSegment], int] = isize, ) -> None: - """Resets mate pair information between two records that share a query name. + """Resets mate pair information between two primary alignments that share a query name. Args: rec1: The first record in the pair. @@ -909,11 +909,11 @@ def set_mate_info( Raises: ValueError: If rec1 and rec2 are of the same read ordinal. - ValueError: If either rec1 or rec2 is supplementary (and not purely primary or secondary). + ValueError: If either rec1 or rec2 is secondary or supplementary. ValueError: If rec1 and rec2 do not share the same query name. """ for dest, source in [(rec1, rec2), (rec2, rec1)]: - _set_common_mate_fields(dest=dest, source=source) + _set_common_mate_fields(dest=dest, mate_primary=source) template_length = isize(rec1, rec2) rec1.template_length = template_length @@ -934,15 +934,13 @@ def set_mate_info_on_secondary(secondary: AlignedSegment, mate_primary: AlignedS Raises: ValueError: If secondary and mate_primary are of the same read ordinal. ValueError: If secondary and mate_primary do not share the same query name. - ValueError: If mate_primary is not purely a primary alignment. + ValueError: If mate_primary is secondary or supplementary. ValueError: If secondary is not marked as a secondary alignment. """ - if mate_primary.is_secondary or mate_primary.is_supplementary: - raise ValueError("The mate primary must not be secondary or supplementary!") if not secondary.is_secondary: raise ValueError("Cannot set mate info on an alignment not marked as secondary!") - _set_common_mate_fields(dest=secondary, source=mate_primary) + _set_common_mate_fields(dest=secondary, mate_primary=mate_primary) def set_mate_info_on_supplementary(supp: AlignedSegment, mate_primary: AlignedSegment) -> None: @@ -955,15 +953,13 @@ def set_mate_info_on_supplementary(supp: AlignedSegment, mate_primary: AlignedSe Raises: ValueError: If supp and mate_primary are of the same read ordinal. ValueError: If supp and mate_primary do not share the same query name. - ValueError: If mate_primary is not purely a primary alignment. + ValueError: If mate_primary is secondary or supplementary. ValueError: If supp is not marked as a supplementary alignment. """ - if mate_primary.is_secondary or mate_primary.is_supplementary: - raise ValueError("The mate primary must not be secondary or supplementary!") if not supp.is_supplementary: raise ValueError("Cannot set mate info on an alignment not marked as supplementary!") - _set_common_mate_fields(dest=supp, source=mate_primary) + _set_common_mate_fields(dest=supp, mate_primary=mate_primary) # NB: for a non-secondary supplemental alignment, set the following to the same as the primary. if not supp.is_secondary: diff --git a/tests/fgpyo/sam/test_sam.py b/tests/fgpyo/sam/test_sam.py index 10cc5da8..6d3dd92a 100755 --- a/tests/fgpyo/sam/test_sam.py +++ b/tests/fgpyo/sam/test_sam.py @@ -692,7 +692,7 @@ def test_set_mate_info_raises_not_opposite_read_ordinals() -> None: r1 = builder.add_single(name="x", read_num=1) r2 = builder.add_single(name="x", read_num=1) with pytest.raises( - ValueError, match="source and dest records must be of different read ordinals!" + ValueError, match="mate_primary and dest records must be of different read ordinals!" ): set_mate_info(r1, r2) @@ -703,7 +703,9 @@ def test_set_mate_info_raises_when_second_rec_is_supplementary() -> None: r1 = builder.add_single(name="x", read_num=1) r2 = builder.add_single(name="x", read_num=2) r2.is_supplementary = True - with pytest.raises(ValueError, match="Mate info must be set from a non-supplementary source!"): + with pytest.raises( + ValueError, match="Mate info must be set from a non-supplementary non-secondary record!" + ): set_mate_info(r1, r2) @@ -864,15 +866,16 @@ def test_set_mate_info_on_secondary_raises_for_secondary_or_supp_rec2() -> None: builder = SamBuilder() r1 = builder.add_single(name="x", read_num=1) r2 = builder.add_single(name="x", read_num=2) + r1.is_secondary = True r2.is_secondary = True with pytest.raises( - ValueError, match="The mate primary must not be secondary or supplementary!" + ValueError, match="Mate info must be set from a non-supplementary non-secondary record!" ): set_mate_info_on_secondary(r1, r2) r2.is_secondary = False r2.is_supplementary = True with pytest.raises( - ValueError, match="The mate primary must not be secondary or supplementary!" + ValueError, match="Mate info must be set from a non-supplementary non-secondary record!" ): set_mate_info_on_secondary(r1, r2) @@ -923,15 +926,16 @@ def test_set_mate_info_on_supplementary_raises_for_secondary_or_supp_rec2() -> N builder = SamBuilder() r1 = builder.add_single(name="x", read_num=1) r2 = builder.add_single(name="x", read_num=2) + r1.is_supplementary = True r2.is_secondary = True with pytest.raises( - ValueError, match="The mate primary must not be secondary or supplementary!" + ValueError, match="Mate info must be set from a non-supplementary non-secondary record!" ): set_mate_info_on_supplementary(r1, r2) r2.is_secondary = False r2.is_supplementary = True with pytest.raises( - ValueError, match="The mate primary must not be secondary or supplementary!" + ValueError, match="Mate info must be set from a non-supplementary non-secondary record!" ): set_mate_info_on_supplementary(r1, r2)