conda cannot install bowtie1.3.0-2

[ylang0825]

Description of the bug

Hello, I met a problem asking for help.
It seems that conda cannot install bowtie1.3.0-2, so the program stopped. I searched bowtie packages through 'conda search bowtie' and found that only bowtie1.3.0 is available and bowtie1.3.0-2 does not exist. I installed bowtie1.3.0 but did not solve this problem. I also searched bowtie in many other conda channels, but did not find anything name bowtie1.3.0-2. I even renamed bowtie as bowtie1.3.0-2 but did not prevented the pipeline from installing bowtie1.3.0-2 online.
Thanks for your advice!

Command used and terminal output

nextflow run nf-core/smrnaseq --input ./samplesheet2.csv --outdir ./results --genome GRCh38 -profile conda --mirtrace_species hsa --three_prime_adapter AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA -r dev

Creating env using conda: bowtie=1.3.0-2 bioconda::samtools=1.13 [cache /home/lang/work/conda/env-15daa4098f37a607b35089adcaff6190]
WARN: Access to undefined parameter `fasta` -- Initialise it to a default value eg. `params.fasta = some_value`
ERROR ~ Error executing process > 'NFCORE_SMRNASEQ:MIRNA_QUANT:BOWTIE_MAP_MATURE (1)'

Caused by:
  Failed to create Conda environment
  command: conda create --mkdir --yes --quiet --prefix /home/lang/work/conda/env-15daa4098f37a607b35089adcaff6190 bowtie=1.3.0-2 bioconda::samtools=1.13
  status : 1
  message:
    Channels:
     - defaults
     - bioconda
    Platform: linux-64
    Collecting package metadata (repodata.json): ...working... done
    Solving environment: ...working... failed
    
    PackagesNotFoundError: The following packages are not available from current channels:
    
      - bioconda::samtools==1.13
      - bowtie=1.3.0-2*
    
    Current channels:
    
      - defaults
      - https://conda.anaconda.org/bioconda
    
    To search for alternate channels that may provide the conda package you're
    looking for, navigate to
    
        https://anaconda.org
    
    and use the search bar at the top of the page.



 -- Check '.nextflow.log' file for details

Relevant files

No response

System information

No response