You signed in with another tab or window. Reload to refresh your session.You signed out in another tab or window. Reload to refresh your session.You switched accounts on another tab or window. Reload to refresh your session.Dismiss alert
What steps will reproduce the problem?
$ cat test_empty_seq_line.fa
>test1
>test2
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
>test3
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT
$ /software/ea-utils/ea-utils-svn/bin/fastq-mcf test_noseq_line.fa test.fq.gz
Scale used: 2.2
Phred: 33
Threshold used: 751 out of 300000
Adapter test1 (): counted 300000 at the 'start' of
'DMPABP_JO15_Gal4.clean.fq.gz', clip set to 0, warning end was not reliable
Adapter test3 (TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT): counted
11363 at the 'end' of 'DMPABP_JO15_Gal4.clean.fq.gz', clip set to 4
Files: 1
Floating point exception (core dumped)
$ cat test_no_seq_line.fa
>test1
>test2
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
>test3
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT
$ /software/ea-utils/ea-utils-svn/bin/fastq-mcf test_no_seq_line.fa test.fq.gz
Malformed adapter fasta record at line 3
Scale used: 2.2
Phred: 33
Threshold used: 751 out of 300000
No adapters found, no skewing detected, and no trimming needed.
Files: 1
@HWI-ST571:356:C2C51ACXX:4:1201:1288:2123 1:N:0:TTTGGC
GACTCCTGAGTAGCTGGGATTACGGGCGCAGGCCACCACACCCAGCTAATT
+
C@@FFFFDHGHBFGDIGIBGHIIIJIH):@GGBH@FHIJDHJIEAAEEHAE
@HWI-ST571:356:C2C51ACXX:4:1201:1326:2156 1:N:0:TTAGGC
CAGGGGAAACTTGGCCTCGATGGGCACCAGGGTGGTGTAGGTCTGTTTCAC
+
...
$ cat test_no_seq_line_with2seq.fa
>test1
>test2
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
$ /software/ea-utils/ea-utils-svn/bin/fastq-mcf test_no_seq_line_with2seqs.fa
test.fq.gz | head -n50
Scale used: 2.2
Phred: 33
Threshold used: 751 out of 300000
No adapters found, no skewing detected, and no trimming needed.
Files: 1
@HWI-ST571:356:C2C51ACXX:4:1201:1288:2123 1:N:0:TTTGGC
GACTCCTGAGTAGCTGGGATTACGGGCGCAGGCCACCACACCCAGCTAATT
+
C@@FFFFDHGHBFGDIGIBGHIIIJIH):@GGBH@FHIJDHJIEAAEEHAE
@HWI-ST571:356:C2C51ACXX:4:1201:1326:2156 1:N:0:TTAGGC
CAGGGGAAACTTGGCCTCGATGGGCACCAGGGTGGTGTAGGTCTGTTTCAC
+
CCCFFFFFHHHHHJJJJJJHIJJJJJJJJJJJ?DH@FFGIJFHGGHGIJJJ
...
What is the expected output? What do you see instead?
When an empty sequence is given in the adapter.fa file, fastq-mcf crashes.
When a corrupt adapter.fa file is given (lines next after each other start both
with ">"), only a warning is printed when there are 2.5 sequences.
When a corrupt adapter.fa file is given (lines next after each other start both
with ">"), no warning is printed when there are 1.5 sequences.
It would be nice if those problems could be fixed.
Instead of a warning that is displayed when there is something wrong in the
adapter.fa file, it might be a good idea to error out by default if that
happens (with optionally an option to override this behaviour).
What version of the product are you using? On what operating system?
svn version
Original issue reported on code.google.com by [email protected] on 4 Dec 2013 at 7:09
The text was updated successfully, but these errors were encountered:
Original issue reported on code.google.com by
[email protected]
on 4 Dec 2013 at 7:09The text was updated successfully, but these errors were encountered: