Starting Trycycler reconcile (2020-07-08 15:29:22)
    Trycycler reconcile is a tool for reconciling multiple alternative contigs
with each other.

Input reads: reads.fastq.gz
  size = 216,254,308 bytes

Input contigs:
  trycycler/cluster_001/1_contigs/A_contig_1.fasta (1,037,018 bp)
  trycycler/cluster_001/1_contigs/B_contig_3.fasta (1,036,565 bp)
  trycycler/cluster_001/1_contigs/C_contig_3.fasta (998,838 bp)
  trycycler/cluster_001/1_contigs/D_contig_1.fasta (1,036,820 bp)
  trycycler/cluster_001/1_contigs/E_contig_3.fasta (1,036,795 bp)
  trycycler/cluster_001/1_contigs/F_utg000001c.fasta (1,042,360 bp)
  trycycler/cluster_001/1_contigs/G_utg000001c.fasta (1,042,247 bp)
  trycycler/cluster_001/1_contigs/H_utg000001c.fasta (1,042,318 bp)
  trycycler/cluster_001/1_contigs/I_utg000001l.fasta (958,895 bp)
  trycycler/cluster_001/1_contigs/J_utg000001c.fasta (1,042,635 bp)

Checking required software:
  minimap2: v2.17-r954-dirty


Initial check of contigs (2020-07-08 15:29:22)
    Before proceeding, Trycycler ensures that the input contigs appear
sufficiently close to each other to make a consensus. If not, the program will
quit and the user must fix the input contigs (make them more similar to each
other) or exclude some before trying again.

Relative sequence lengths:
  A_contig_1:   1.000  1.000  1.038  1.000  1.000  0.995  0.995  0.995  1.081  0.995
  B_contig_3:   1.000  1.000  1.038  1.000  1.000  0.994  0.995  0.994  1.081  0.994
  C_contig_3:   0.963  0.964  1.000  0.963  0.963  0.958  0.958  0.958  1.042  0.958
  D_contig_1:   1.000  1.000  1.038  1.000  1.000  0.995  0.995  0.995  1.081  0.994
  E_contig_3:   1.000  1.000  1.038  1.000  1.000  0.995  0.995  0.995  1.081  0.994
  F_utg000001c: 1.005  1.006  1.044  1.005  1.005  1.000  1.000  1.000  1.087  1.000
  G_utg000001c: 1.005  1.005  1.043  1.005  1.005  1.000  1.000  1.000  1.087  1.000
  H_utg000001c: 1.005  1.006  1.044  1.005  1.005  1.000  1.000  1.000  1.087  1.000
  I_utg000001l: 0.925  0.925  0.960  0.925  0.925  0.920  0.920  0.920  1.000  0.920
  J_utg000001c: 1.005  1.006  1.044  1.006  1.006  1.000  1.000  1.000  1.087  1.000

Mash distances:
  A_contig_1:   0.000  0.004  0.005  0.004  0.004  0.006  0.006  0.006  0.008  0.006
  B_contig_3:   0.004  0.000  0.005  0.004  0.004  0.006  0.006  0.006  0.008  0.006
  C_contig_3:   0.005  0.005  0.000  0.005  0.005  0.007  0.006  0.007  0.009  0.007
  D_contig_1:   0.004  0.004  0.005  0.000  0.004  0.006  0.006  0.006  0.008  0.006
  E_contig_3:   0.003  0.004  0.005  0.003  0.000  0.006  0.005  0.005  0.008  0.006
  F_utg000001c: 0.006  0.006  0.007  0.006  0.006  0.000  0.004  0.004  0.006  0.004
  G_utg000001c: 0.006  0.006  0.006  0.006  0.005  0.004  0.000  0.004  0.006  0.004
  H_utg000001c: 0.006  0.007  0.007  0.006  0.006  0.004  0.004  0.000  0.006  0.004
  I_utg000001l: 0.008  0.008  0.009  0.008  0.008  0.006  0.006  0.006  0.000  0.006
  J_utg000001c: 0.006  0.006  0.007  0.006  0.006  0.004  0.004  0.004  0.006  0.000

Contigs have passed the initial check - they seem sufficiently close to reconcile.


Normalising strands (2020-07-08 15:29:25)
    In this step, Trycycler ensures that all sequences are on the same strand.
It does this by first finding a sequence that occurs once in each contig and
then flipping any of the contigs (converting to their reverse complement
sequence) which have this sequence on the negative strand.

Randomly-chosen common sequence:
  CGATATGCTGACAGTCGTAATTGTAAGAACAATCGCAGTTGGAATCCACG
  GTGTCAGATTCCGCTCGATCTACTTCAATTTCGCACTCGTAAACGTTATC
  GTACGAACCACGAATTTGTGCGCTAATACACACCGTCTCGCCATTCATAG
  ATAAGATTTTGGCACTAACCACAGCTCCTTGAGCAAATAACTCTTTTCCA
  TCTTGCAGTATGTTAGCTGTAAAATCTCTTCTTAATTTACGAAAATTAAG

A_contig_1:   + strand (using original sequence)
B_contig_3:   - strand (using reverse complement)
C_contig_3:   + strand (using original sequence)
D_contig_1:   + strand (using original sequence)
E_contig_3:   - strand (using reverse complement)
F_utg000001c: + strand (using original sequence)
G_utg000001c: + strand (using original sequence)
H_utg000001c: + strand (using original sequence)
I_utg000001l: + strand (using original sequence)
J_utg000001c: - strand (using reverse complement)


Circularisation (2020-07-08 15:29:28)
    Trycycler now compares the contigs to each other to repair any
circularisation issues. After this step, each sequence should be cleanly
circularised - i.e. the first base in the contig immediately follows the last
base. Each contig will be circularised by looking for the position of its start
and end in the other contigs. If necessary, additional sequence will be added
or duplicated sequence will be removed. If there are multiple possible ways to
fix a contig's circularisation, then Trycycler will use read alignments to
choose the best one.

Circularising A_contig_1:
  using B_contig_3:
    circularising A_contig_1 by adding 2 bp of sequence from B_contig_3 (412936-412938)
  using C_contig_3:
    circularising A_contig_1 by adding 2 bp of sequence from C_contig_3 (620999-621001)
  using D_contig_1:
    circularising A_contig_1 by adding 2 bp of sequence from D_contig_1 (414449-414451)
  using E_contig_3:
    circularising A_contig_1 by adding 2 bp of sequence from E_contig_3 (485442-485444)
  using F_utg000001c:
    circularising A_contig_1 by adding 2 bp of sequence from F_utg000001c (785926-785928)
  using G_utg000001c:
    circularising A_contig_1 by adding 2 bp of sequence from G_utg000001c (132089-132091)
  using H_utg000001c:
    circularising A_contig_1 by adding 2 bp of sequence from H_utg000001c (833839-833841)
  using I_utg000001l:
    circularising A_contig_1 by adding 2 bp of sequence from I_utg000001l (549328-549330)
  using J_utg000001c:
    circularising A_contig_1 by adding 2 bp of sequence from J_utg000001c (654628-654630)
  circularisation complete (1,037,020 bp)

Circularising B_contig_3:
  using A_contig_1:
    circularising B_contig_3 by trimming 340 bp of sequence from the end
  using C_contig_3:
    circularising B_contig_3 by trimming 340 bp of sequence from the end
  using D_contig_1:
    circularising B_contig_3 by trimming 340 bp of sequence from the end
  using E_contig_3:
    circularising B_contig_3 by trimming 340 bp of sequence from the end
  using F_utg000001c:
    circularising B_contig_3 by trimming 340 bp of sequence from the end
  using G_utg000001c:
    circularising B_contig_3 by trimming 340 bp of sequence from the end
  using H_utg000001c:
    circularising B_contig_3 by trimming 340 bp of sequence from the end
  using I_utg000001l:
    circularising B_contig_3 by trimming 340 bp of sequence from the end
  using J_utg000001c:
    circularising B_contig_3 by trimming 340 bp of sequence from the end
  circularisation complete (1,036,225 bp)

Circularising C_contig_3:
  using A_contig_1:
    circularising C_contig_3 by adding 106 bp of sequence from A_contig_1 (377895-378001)
  using B_contig_3:
    circularising C_contig_3 by adding 106 bp of sequence from B_contig_3 (790614-790720)
  using D_contig_1:
    circularising C_contig_3 by adding 106 bp of sequence from D_contig_1 (792251-792357)
  using E_contig_3:
    unable to circularise: C_contig_3's end could not be found in E_contig_3
  using F_utg000001c:
    circularising C_contig_3 by adding 107 bp of sequence from F_utg000001c (123298-123405)
  using G_utg000001c:
    circularising C_contig_3 by adding 106 bp of sequence from G_utg000001c (511731-511837)
  using H_utg000001c:
    circularising C_contig_3 by adding 107 bp of sequence from H_utg000001c (171244-171351)
  using I_utg000001l:
    circularising C_contig_3 by adding 107 bp of sequence from I_utg000001l (929036-929143)
  using J_utg000001c:
    circularising C_contig_3 by adding 107 bp of sequence from J_utg000001c (1034445-1034552)
  choosing best circularisation of 2 alternatives
    alternative 1 (998,944 bp): score = 168,245,959
    alternative 2 (998,945 bp): score = 168,245,951
    best alternative: 1
  circularisation complete (998,944 bp)

Circularising D_contig_1:
  using A_contig_1:
    circularising D_contig_1 by adding 9 bp of sequence from A_contig_1 (622521-622530)
  using B_contig_3:
    unable to circularise: D_contig_1's end could not be found in B_contig_3
  using C_contig_3:
    circularising D_contig_1 by adding 9 bp of sequence from C_contig_3 (244440-244449)
  using E_contig_3:
    circularising D_contig_1 by adding 9 bp of sequence from E_contig_3 (70927-70936)
  using F_utg000001c:
    circularising D_contig_1 by adding 9 bp of sequence from F_utg000001c (369169-369178)
  using G_utg000001c:
    circularising D_contig_1 by adding 9 bp of sequence from G_utg000001c (757648-757657)
  using H_utg000001c:
    circularising D_contig_1 by adding 9 bp of sequence from H_utg000001c (417198-417207)
  using I_utg000001l:
    circularising D_contig_1 by adding 9 bp of sequence from I_utg000001l (132550-132559)
  using J_utg000001c:
    circularising D_contig_1 by adding 9 bp of sequence from J_utg000001c (237744-237753)
  circularisation complete (1,036,829 bp)

Circularising E_contig_3:
  using A_contig_1:
    circularising E_contig_3 by adding 138 bp of sequence from A_contig_1 (551479-551617)
  using B_contig_3:
    circularising E_contig_3 by adding 139 bp of sequence from B_contig_3 (964168-964307)
  using C_contig_3:
    circularising E_contig_3 by adding 137 bp of sequence from C_contig_3 (173395-173532)
  using D_contig_1:
    circularising E_contig_3 by adding 139 bp of sequence from D_contig_1 (965782-965921)
  using F_utg000001c:
    circularising E_contig_3 by adding 140 bp of sequence from F_utg000001c (297759-297899)
  using G_utg000001c:
    circularising E_contig_3 by adding 140 bp of sequence from G_utg000001c (686233-686373)
  using H_utg000001c:
    circularising E_contig_3 by adding 140 bp of sequence from H_utg000001c (345793-345933)
  using I_utg000001l:
    circularising E_contig_3 by adding 140 bp of sequence from I_utg000001l (61140-61280)
  using J_utg000001c:
    circularising E_contig_3 by adding 138 bp of sequence from J_utg000001c (166358-166496)
  choosing most common circularisation
  circularisation complete (1,036,935 bp)

Circularising F_utg000001c:
  using A_contig_1:
    unable to circularise: F_utg000001c's start and end were found in multiple places in A_contig_1
  using B_contig_3:
    unable to circularise: F_utg000001c's start and end were found in multiple places in B_contig_3
  using C_contig_3:
    unable to circularise: F_utg000001c's start and end were found in multiple places in C_contig_3
  using D_contig_1:
    unable to circularise: F_utg000001c's start and end were found in multiple places in D_contig_1
  using E_contig_3:
    unable to circularise: F_utg000001c's start and end were found in multiple places in E_contig_3
  using G_utg000001c:
    unable to circularise: F_utg000001c's start and end were found in multiple places in G_utg000001c
  using H_utg000001c:
    unable to circularise: F_utg000001c's start and end were found in multiple places in H_utg000001c
  using I_utg000001l:
    unable to circularise: F_utg000001c's start and end were found in multiple places in I_utg000001l
  using J_utg000001c:
    unable to circularise: F_utg000001c's start and end were found in multiple places in J_utg000001c

Error: failed to circularise sequence F_utg000001c because its start/end
sequences were found in multiple ambiguous places in other sequences. This is
likely because F_utg000001c starts/ends in a repetitive region. You can either
manually repair its circularisation (and ensure it does not start/end in a
repetitive region) or exclude the sequence altogether and try again.