The program mason_splicing
allows one to construct transcripts from a GFF/GTF file, a
reference sequence and an optional variant file.
There are example files in the examples
directory.
The command:
$ mason_splicing --help
prints the help for Mason Splicing.
We can use mason_splicing to simulate the transcript from a GFF file and its reference. Note that this would also work with a GTF file:
$ mason_splicing -ir adeno_virus_b.fa -ig adeno_virus_b.gff -o out.fa \
--gff-type cds --gff-group-by translation_id
...
$ head out.fa
>pro.1
TTATGGCCTGGGGCGTTTACAGCTCAAGTCCAAAGGTTGCCCAGACTCGTTAAGCAAGTCCTCGATACAT
TCCACAGCCTGGCGACGCCCACCAACTCTCACGGCAACTGGTTTAATGGGGCACAGCGGGACCACCGGGT
GTATCTCAGGAGGTGTGTTAGAAGGACCGGAGTCACAGCTATCCGTACTACTATTGCATTCTCTAGACAC
AGGTGATGTCGGGCGTCTCAGGATAGCAGGCACCAATTTAGGACGCCGGGTAGGTCTTGCAGGCTCCGGT
TCTGGCTCGGGCTCAGGCTCAGGTTCAGACACAGGACCTTTTAAAAAATCACAATACAAAATTCTTTAAA
CCACAAAACTGTAAAAATTAAAAAAAAATTACCACACCAAACCCACCACTCTATCACCGACTGCCCATAA
TTTTCACTTACTGTAGACAAACATGCCACAGGTCCTCATATAGCAAAGCGAACACATAATATCTGGGTCC
CCCGTATTCCTCCGGTGATAATGACAAGACCTGCAACCGTGCCCGGGGTGCTCCACATAATCTAACACAA
ACTCCTCACCCTCTTCATCCTCGTCGTCACTGGGTGGAAAGCCAGCCTCGTGGCAGGTAAGATCGATCAC
Besides the path to the input FASTA and GFF file and the output FASTA file, we also give the parameters --gff-type and --gff-group-by.
The GFF type is the value of the third column (in both GFF and GTF) to filter for. Here, we use "cds", another value could be "exon".
The GFF group-by key is the name of a key/tag from the last column of the GTF/GTF file. Here, this is transcript_id, for your data this could also be "Parent", for example.
mason_splicing will read in the reference FASTA file and the GFF file. For each group of GFF/GTF records with the same "group-by" key, it will generate one sequence in the output FASTA file. For this, it will take all records with the type given by --gff-type and concatenate the sequence from these features in the order that they occur in in the genome.