alirna.ps

%!PS-Adobe-3.0 EPSF-3.0
%%Creator: PS_dot.c,v 1.38 2007/02/02 15:18:13 ivo Exp $, ViennaRNA-2.1.2
%%CreationDate: Mon Aug 26 11:09:05 2013
%%Title: RNA Secondary Structure Plot
%%BoundingBox: 66 210 518 662
%%DocumentFonts: Helvetica
%%Pages: 1
%%EndComments

%Options: -d2 
% to switch off outline pairs of sequence comment or
% delete the appropriate line near the end of the file

%%BeginProlog
/RNAplot 100 dict def
RNAplot begin
/fsize  14 def
/outlinecolor {0.2 setgray} bind def
/paircolor    {0.2 setgray} bind def
/seqcolor     {0   setgray} bind def
/cshow  { dup stringwidth pop -2 div fsize -3 div rmoveto show} bind def
/min { 2 copy gt { exch } if pop } bind def
/max { 2 copy lt { exch } if pop } bind def
/arccoords { % i j arccoords
  % puts optimal x1 y1 x2 y2 coordinates used in bezier curves from i to j
  % onto the stack
  dup 3 -1 roll dup 4 -1 roll lt dup dup 5 2 roll {exch} if
  dup 3 -1 roll dup 3 -1 roll exch sub 1 sub dup
  4 -2 roll 5 -1 roll {exch} if 4 2 roll
  sequence length dup 2 div exch 3 1 roll lt 
  {exch 5 -1 roll pop 4 -2 roll exch 4 2 roll}
  { 4 2 roll 5 -1 roll dup 6 1 roll {exch} if
    4 -2 roll exch pop dup 3 -1 roll dup 4 1 roll
    exch add 4 -1 roll dup 5 1 roll sub 1 sub
    5 -1 roll not {4 -2 roll exch 4 2 roll} if
  }ifelse
   % compute the scalingfactor and prepare (1-sf) and sf*r
  2 mul exch cpr 3 1 roll div dup
  3 -1 roll mul exch 1 exch sub exch
   % compute the coordinates
  3 -1 roll 1 sub coor exch get aload pop % get coord for i
  4 -1 roll dup 5 1 roll mul 3 -1 roll dup 4 1 roll add exch % calculate y1
  4 -1 roll dup 5 1 roll mul 3 -1 roll dup 4 1 roll add exch % calculate x1
  5 -1 roll 1 sub coor exch get aload pop % get coord for j
  % duplicate j coord
  dup 3 -1 roll dup 4 1 roll exch 8 2 roll
  6 -1 roll dup 7 1 roll mul 5 -1 roll dup 6 1 roll add exch % calculate y2
  6 -1 roll mul 5 -1 roll add exch % calculate x2
  6 -2 roll % reorder
} bind def
/drawoutline {
  gsave outlinecolor newpath
  coor 0 get aload pop 0.8 0 360 arc % draw 5' circle of 1st sequence
  currentdict /cutpoint known        % check if cutpoint is defined
  {coor 0 cutpoint getinterval
   {aload pop lineto} forall         % draw outline of 1st sequence
   coor cutpoint 1 add get aload pop
   2 copy moveto 0.8 0 360 arc       % draw 5' circle of 2nd sequence
   coor cutpoint 1 add coor length cutpoint 1 add sub getinterval
   {aload pop lineto} forall}        % draw outline of 2nd sequence
  {coor {aload pop lineto} forall}   % draw outline as a whole
  ifelse
  stroke grestore
} bind def
/drawpairs {
  paircolor
  0.7 setlinewidth
  [9 3.01] 9 setdash
  newpath
  pairs {aload pop
      currentdict (cpr) known
      { exch dup
        coor  exch 1 sub get aload pop moveto
        exch arccoords curveto
      }
      { coor exch 1 sub get aload pop moveto
        coor exch 1 sub get aload pop lineto
      }ifelse
  } forall
  stroke
} bind def
% draw bases
/drawbases {
  [] 0 setdash
  seqcolor
  0
  coor {
    aload pop moveto
    dup sequence exch 1 getinterval cshow
    1 add
  } forall
  pop
} bind def

/init {
  /Helvetica findfont fsize scalefont setfont
  1 setlinejoin
  1 setlinecap
  0.8 setlinewidth
  72 216 translate
  % find the coordinate range
  /xmax -1000 def /xmin 10000 def
  /ymax -1000 def /ymin 10000 def
  coor {
      aload pop
      dup ymin lt {dup /ymin exch def} if
      dup ymax gt {/ymax exch def} {pop} ifelse
      dup xmin lt {dup /xmin exch def} if
      dup xmax gt {/xmax exch def} {pop} ifelse
  } forall
  /size {xmax xmin sub ymax ymin sub max} bind def
  72 6 mul size div dup scale
  size xmin sub xmax sub 2 div size ymin sub ymax sub 2 div
  translate
} bind def
end
RNAplot begin
% extra definitions for standard anotations
/min { 2 copy gt { exch } if pop } bind def
/BLACK { 0 0 0 } def
/RED   { 1 0 0 } def
/GREEN { 0 1 0 } def
/BLUE  { 0 0 1 } def
/WHITE { 1 1 1 } def
/LabelFont { % font size LabelFont
  exch findfont exch fsize mul scalefont setfont
} bind def
/Label { % i dx dy (text) Label
  % write text at base i plus offset dx, dy
  4 3 roll 1 sub coor exch get aload pop moveto
  3 1 roll fsize mul exch fsize mul exch rmoveto
  show
} bind def
/cmark { % i cmark   draw circle around base i
  newpath 1 sub coor exch get aload pop
  fsize 2 div 0 360 arc stroke
} bind def
/gmark { % i j c gmark
  % draw basepair i,j with c counter examples in gray
  gsave
  3 min [0 0.33 0.66 0.9] exch get setgray
  1 sub dup coor exch get aload pop moveto
  sequence exch 1 getinterval cshow
  1 sub dup coor exch get aload pop moveto
  sequence exch 1 getinterval cshow
  grestore
} bind def
/segmark { % f i j lw r g b segmark
  % mark segment [i,j] with outline width lw and color rgb
  % use omark and Fomark instead
  gsave
  setrgbcolor setlinewidth
  newpath
  1 sub exch 1 sub dup
  coor exch get aload pop moveto
  currentdict (cpr) known
  {
    3 -1 roll dup 4 1 roll dup
    {
      3 1 roll dup 3 -1 roll dup
      4 1 roll exch 5 2 roll exch
    }
    {
      3 1 roll exch
    } ifelse
    1 exch { coor exch get aload pop lineto } for
    {
      dup 3 1 roll 1 add exch 1 add arccoords pop pop
      4 2 roll 5 -1 roll coor exch get aload pop curveto
    } if
  }
  {
    exch 1 exch {
      coor exch get aload pop lineto
    } for
  } ifelse
  { closepath fill } if  stroke
  grestore
} bind def
/omark { % i j lw r g b omark
  % stroke segment [i..j] with linewidth lw, color rgb
  false 7 1 roll segmark
} bind def
/Fomark { % i j r g b Fomark
  % fill segment [i..j] with color rgb
  % should precede drawbases
  1 4 1 roll true 7 1 roll segmark
} bind def
/BFmark{ % i j k l r g b BFmark
  % fill block between pairs (i,j) and (k,l) with color rgb
  % should precede drawbases
  gsave
  setrgbcolor
  newpath
  currentdict (cpr) known
  {
    dup 1 sub coor exch get aload pop moveto % move to l
    dup 1 sub 4 -1 roll dup 5 1 roll 1 sub 1 exch
    { coor exch get aload pop lineto } for % lines from l to j
    3 -1 roll 4 -1 roll dup 5 1 roll arccoords curveto % curve from j to i
    exch dup 4 -1 roll 1 sub exch 1 sub 1 exch
    { coor exch get aload pop lineto } for % lines from i to k
    exch arccoords curveto% curve from k to l
  }
  {  exch 4 3 roll exch 1 sub exch 1 sub dup
     coor exch get aload pop moveto
     exch 1 exch { coor exch get aload pop lineto } for
     exch 1 sub exch 1 sub dup
     coor exch get aload pop lineto
     exch 1 exch { coor exch get aload pop lineto } for
  } ifelse
    closepath fill stroke
   grestore
} bind def
/hsb {
  dup 0.3 mul 1 exch sub sethsbcolor
} bind def
/colorpair { % i j hue sat colorpair
  % draw basepair i,j in color
  % 1 index 0.00 ne {
  gsave
  newpath
  hsb
  fsize setlinewidth
  currentdict (cpr) known
  {
    exch dup
    coor  exch 1 sub get aload pop moveto
    exch arccoords curveto
  }
  { 1 sub coor exch get aload pop moveto
    1 sub coor exch get aload pop lineto
  } ifelse
   stroke
   grestore
   % } if
} bind def
end

%%EndProlog
RNAplot begin
% data start here
/sequence (\
_GACUUCGGUCC_AAGCUAAUGCACUCUGAUGAUCGCGUGGAUAU_GGCACGCAUUGAAUUGUUGGACACCGU___AAAU_GUCCUAACACGGGCGCAUCGGGCUUCGGUCCGGUUC\
) def
/coor [
[156.57707214 267.27508545]
[146.28674316 270.40966797]
[135.82464600 272.91186523]
[125.22961426 274.77239990]
[114.54094696 275.98431396]
[103.79831696 276.54318237]
[93.04159546 276.44686890]
[82.31069183 275.69577026]
[71.64543915 274.29269409]
[61.08540726 272.24276733]
[50.66978836 269.55368042]
[40.43723297 266.23538208]
[30.42571831 262.30014038]
[20.67239380 257.76263428]
[11.21345329 252.63967896]
[2.08400059 246.95025635]
[-6.68208456 240.71549988]
[-15.05227184 233.95855713]
[-22.99549866 226.70448303]
[-30.48228836 218.98022461]
[-37.48485947 210.81440735]
[-43.97721863 202.23738098]
[-49.93527985 193.28092957]
[-55.33692932 183.97831726]
[-60.16212463 174.36407471]
[-64.39295197 164.47384644]
[-68.01371765 154.34436035]
[-71.01098633 144.01321411]
[-73.37362671 133.51872253]
[-75.09288025 122.89984894]
[-76.16236115 112.19599152]
[-76.57810211 101.44686890]
[-76.33856201 90.69238281]
[-75.44462585 79.97243500]
[-73.89961243 69.32681274]
[-71.70925903 58.79501724]
[-68.88169098 48.41613388]
[-65.42739868 38.22867966]
[-61.35920715 28.27045822]
[-56.69220734 18.57842636]
[-51.44372177 9.18855095]
[-45.63322830 0.13567668]
[-39.28228760 -8.54660034]
[-32.41447067 -16.82605934]
[-25.05526352 -24.67197609]
[-17.23197365 -32.05523300]
[-8.97363377 -38.94843292]
[-0.31089342 -45.32599640]
[8.72410202 -51.16424942]
[18.09782219 -56.44153595]
[27.77548409 -61.13826370]
[37.72116852 -65.23700714]
[47.89797211 -68.72254944]
[58.26812744 -71.58197021]
[68.79315186 -73.80464172]
[79.43398285 -75.38232422]
[90.15113068 -76.30915833]
[100.90483093 -76.58171082]
[111.65517426 -76.19896698]
[122.36226654 -75.16235352]
[132.98637390 -73.47570038]
[143.48806763 -71.14528656]
[153.82836914 -68.17974854]
[163.96891785 -64.59008789]
[173.87208557 -60.38964081]
[183.50109863 -55.59398270]
[192.82025146 -50.22091293]
[201.79493713 -44.29037094]
[210.39186096 -37.82437134]
[218.57913208 -30.84690094]
[226.32633972 -23.38385582]
[233.60475159 -15.46293354]
[240.38735962 -7.11352730]
[246.64900208 1.63337851]
[252.36640930 10.74532318]
[257.51840210 20.18849373]
[262.08581543 29.92784500]
[266.05175781 39.92723465]
[269.40145874 50.14955521]
[272.12252808 60.55686951]
[274.20483398 71.11055756]
[275.64065552 81.77145386]
[276.42468262 92.50000000]
[291.42468262 92.50000000]
[306.42468262 92.50000000]
[317.42138672 81.14886475]
[333.22479248 80.98176575]
[344.45901489 92.09785461]
[344.45901489 107.90214539]
[333.22479248 119.01823425]
[317.42138672 118.85113525]
[306.42468262 107.50000000]
[291.42468262 107.50000000]
[276.42468262 107.50000000]
[270.61013794 145.54232788]
[256.69219971 181.42156982]
[235.33197021 213.43357849]
[207.54396057 240.05790710]
[216.16577148 252.33244324]
[224.78758240 264.60699463]
[233.40939331 276.88153076]
[242.03120422 289.15606689]
[250.65301514 301.43060303]
[259.27484131 313.70516968]
[274.36758423 320.11926270]
[276.09033203 336.42767334]
[262.67086792 345.85369873]
[247.91398621 338.70065308]
[247.00028992 322.32696533]
[238.37847900 310.05242920]
[229.75666809 297.77789307]
[221.13485718 285.50335693]
[212.51304626 273.22879028]
[203.89123535 260.95425415]
[195.26942444 248.67971802]
[186.03956604 254.20477295]
[176.49043274 259.15759277]
] def
/pairs [
[83 94]
[84 93]
[85 92]
[98 115]
[99 114]
[100 113]
[101 112]
[102 111]
[103 110]
[104 109]
] def

init

% switch off outline pairs or bases by removing these lines
drawoutline
drawpairs
drawbases
% Start Annotations
83 94 2 gmark
83 cmark
84 93 1 gmark
84 cmark
85 92 1 gmark
85 cmark
98 115 2 gmark
99 114 2 gmark
99 cmark

% End Annotations
% show it
showpage
end
%%EOF