-
Notifications
You must be signed in to change notification settings - Fork 55
Commit
This commit does not belong to any branch on this repository, and may belong to a fork outside of the repository.
Signed-off-by: John St John <[email protected]>
- Loading branch information
Showing
1 changed file
with
15 additions
and
4 deletions.
There are no files selected for viewing
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -1,5 +1,5 @@ | ||
- tag: 1b-8k:1.0 | ||
ngc: null | ||
ngc: nvidia/clara/evo2-1b-8k-nemo2:1.0 | ||
ngc_registry: model | ||
pbss: "s3://bionemo-ci/models/nemo2_evo2_1b_8k.tar.gz" | ||
sha256: d663c529ac7ae0b6f2fd3a852253a484bd8a6576992e9ec73045ce7af2365990 # pragma: allowlist secret | ||
|
@@ -17,6 +17,15 @@ | |
description: > | ||
A 7b parameter evo2 model used in testing, torch_dist format. Converted from hf://arcinstitute/savanna_evo2_7b_base. | ||
- tag: 7b-8k-zarr:1.0 | ||
ngc: nvidia/clara/evo2-7b-8k-zarr:1.1 | ||
ngc_registry: model | ||
pbss: "s3://bionemo-ci/models/interleaved_hyena_7b_fix_shape_v2.tar.gz" | ||
sha256: e08d89a1841a6aa3796c772ffe84092f20ac0a11d1b6ef7b1966ebbd8253e17e # pragma: allowlist secret | ||
owner: John St John <[email protected]> | ||
description: > | ||
A 7b parameter evo2 model used in testing, zarr format (deprecated but equivalent to `evo2/7b-8k:1.0`). | ||
- tag: 7b-1m:1.0 | ||
ngc: null | ||
ngc_registry: model | ||
|
@@ -28,7 +37,7 @@ | |
- tag: 7b-8k-nofp8-te-goldvalue-testdata:1.0 | ||
ngc: null | ||
ngc: nvidia/clara/evo2-7b-8k-nofp8-te-goldvalue-testdata:1.0 | ||
ngc_registry: resource | ||
pbss: "s3://bionemo-ci/test_data/evo2/final_7b_no_fp8_golden_value.pt" | ||
sha256: dee5372fc6011dffc3f3933440623993b1870961fec6a24d1a3a874c940259b2 # pragma: allowlist secret | ||
|
@@ -43,7 +52,7 @@ | |
ATAATTTTAATTTATATAAT | ||
- tag: 1b-8k-nofp8-te-goldvalue-testdata-A6000:1.0 | ||
ngc: null | ||
ngc: nvidia/clara/evo2-1b-8k-nofp8-te-goldvalue-testdata-a6000:1.0 | ||
ngc_registry: resource | ||
pbss: "s3://bionemo-ci/test_data/evo2/final_1b_no_fp8_golden_value_A6000.pt" | ||
sha256: 289dc1c4c919162b467c7f068d27fa16e9670cb4a9fd15696198c6a6aac2fa21 # pragma: allowlist secret | ||
|
@@ -56,7 +65,9 @@ | |
TCTTAGCGAAGGACCTCCCCTCTTGCTTGCGTATTGCCCCGCGAAATTTCTTTTCGGCGATGAACGATACAAAAAATTCTATCGAATGTTACTTCTATTCTCTGCCTCGTCTATGA | ||
CTTGGAGATTGGTCTATGTCGTTCGTTTTCTCGCGAGTTTCCAATATGTCCGTAGTATGTGAACGCTGGTATTCGTGAAGATAAATTATTGTTTTTACAATTTCTTTCAAAAATAT | ||
ATAATTTTAATTTATATAAT | ||
The following command was used to get logits after adding the above to a fasta file: | ||
The following command was used to get logits after adding the above to a fasta file. Note in general --fp8 is | ||
required for good prediction accuracy for downstream zero shot tasks for the 1b model. The 7b model is robust to | ||
fp8 precision exclusion at inference time: | ||
```bash | ||
predict_evo2 \ | ||
--fasta test_seq.fasta \ | ||
|