Skip to content

Commit

Permalink
add missing/new NGC urls
Browse files Browse the repository at this point in the history
Signed-off-by: John St John <[email protected]>
  • Loading branch information
jstjohn committed Mar 4, 2025
1 parent aabd6a4 commit 66ead75
Showing 1 changed file with 15 additions and 4 deletions.
Original file line number Diff line number Diff line change
@@ -1,5 +1,5 @@
- tag: 1b-8k:1.0
ngc: null
ngc: nvidia/clara/evo2-1b-8k-nemo2:1.0
ngc_registry: model
pbss: "s3://bionemo-ci/models/nemo2_evo2_1b_8k.tar.gz"
sha256: d663c529ac7ae0b6f2fd3a852253a484bd8a6576992e9ec73045ce7af2365990 # pragma: allowlist secret
Expand All @@ -17,6 +17,15 @@
description: >
A 7b parameter evo2 model used in testing, torch_dist format. Converted from hf://arcinstitute/savanna_evo2_7b_base.
- tag: 7b-8k-zarr:1.0
ngc: nvidia/clara/evo2-7b-8k-zarr:1.1
ngc_registry: model
pbss: "s3://bionemo-ci/models/interleaved_hyena_7b_fix_shape_v2.tar.gz"
sha256: e08d89a1841a6aa3796c772ffe84092f20ac0a11d1b6ef7b1966ebbd8253e17e # pragma: allowlist secret
owner: John St John <[email protected]>
description: >
A 7b parameter evo2 model used in testing, zarr format (deprecated but equivalent to `evo2/7b-8k:1.0`).
- tag: 7b-1m:1.0
ngc: null
ngc_registry: model
Expand All @@ -28,7 +37,7 @@
- tag: 7b-8k-nofp8-te-goldvalue-testdata:1.0
ngc: null
ngc: nvidia/clara/evo2-7b-8k-nofp8-te-goldvalue-testdata:1.0
ngc_registry: resource
pbss: "s3://bionemo-ci/test_data/evo2/final_7b_no_fp8_golden_value.pt"
sha256: dee5372fc6011dffc3f3933440623993b1870961fec6a24d1a3a874c940259b2 # pragma: allowlist secret
Expand All @@ -43,7 +52,7 @@
ATAATTTTAATTTATATAAT
- tag: 1b-8k-nofp8-te-goldvalue-testdata-A6000:1.0
ngc: null
ngc: nvidia/clara/evo2-1b-8k-nofp8-te-goldvalue-testdata-a6000:1.0
ngc_registry: resource
pbss: "s3://bionemo-ci/test_data/evo2/final_1b_no_fp8_golden_value_A6000.pt"
sha256: 289dc1c4c919162b467c7f068d27fa16e9670cb4a9fd15696198c6a6aac2fa21 # pragma: allowlist secret
Expand All @@ -56,7 +65,9 @@
TCTTAGCGAAGGACCTCCCCTCTTGCTTGCGTATTGCCCCGCGAAATTTCTTTTCGGCGATGAACGATACAAAAAATTCTATCGAATGTTACTTCTATTCTCTGCCTCGTCTATGA
CTTGGAGATTGGTCTATGTCGTTCGTTTTCTCGCGAGTTTCCAATATGTCCGTAGTATGTGAACGCTGGTATTCGTGAAGATAAATTATTGTTTTTACAATTTCTTTCAAAAATAT
ATAATTTTAATTTATATAAT
The following command was used to get logits after adding the above to a fasta file:
The following command was used to get logits after adding the above to a fasta file. Note in general --fp8 is
required for good prediction accuracy for downstream zero shot tasks for the 1b model. The 7b model is robust to
fp8 precision exclusion at inference time:
```bash
predict_evo2 \
--fasta test_seq.fasta \
Expand Down

0 comments on commit 66ead75

Please sign in to comment.