sequence-search : add checks on user input, and Search button.

sequence-search.js :
add clearMsgs() (based from data-base.js, with added nameWarning : null), selectedParent.  drop reference to selectedDataset (only present in data-csv)
Add checkInputs(), loading (taskGet not added yet), search(), inputsOK(), searchButtonDisabled(),
Call dnaSequenceInput() from search() (and pass in text) instead of paste().

sequence-search.hbs : add search button and replaceDataset checkbox (value not yet passed to API).

frontend/app/components/panel/sequence-search.js

@@ -1,7 +1,8 @@
 import Component from '@ember/component';
-import { bind, once, later, throttle } from '@ember/runloop';
+import { bind, once, later, throttle, debounce } from '@ember/runloop';
 import { inject as service } from '@ember/service';
 import { observer, computed } from '@ember/object';
+import { alias } from '@ember/object/computed';
 
 
 const dLog = console.debug;
@@ -29,20 +30,30 @@ export default Component.extend({
       errorMessage: msg,
     });
   },
+
+  clearMsgs() {
+    this.setProperties({
+      successMessage: null,
+      errorMessage: null,
+      warningMessage: null,
+      nameWarning : null,
+    });
+  },
+
   /*--------------------------------------------------------------------------*/
   /** copied from data-csv.js; could factor as a mixin. */
   newDatasetName: '',
   nameWarning: null,
+  selectedParent: '',
   /** Checks if entered dataset name is already taken in dataset list
    *  Debounced call through observer */
   isDupName: function() {
-    let selectedMap = this.get('selectedDataset');
-    if (selectedMap === 'new') {
-      let newMap = this.get('newDatasetName');
+    {
+      let datasetName = this.get('newDatasetName');
       let datasets = this.get('datasets');
-      let matched = datasets.findBy('name', newMap);
+      let matched = datasets.findBy('name', datasetName);
       if(matched){
-        this.set('nameWarning', `Dataset name '${newMap}' is already in use`);
+        this.set('nameWarning', `Dataset name '${datasetName}' is already in use`);
         return true;
       }
     }
@@ -52,10 +63,17 @@ export default Component.extend({
   onNameChange: observer('newDatasetName', function() {
     debounce(this, this.isDupName, 500);
   }),
-  onSelectChange: observer('selectedDataset', 'selectedParent', function() {
-    this.clearMsgs();
-    this.isDupName();
-    this.checkBlocks();
+  onSelectChange: observer('selectedParent', function() {
+    this.checkInputs();
+  }),
+
+  /*--------------------------------------------------------------------------*/
+
+  loading : alias('taskGet.isRunning'),
+
+  refreshClassNames : computed('loading', function () {
+    let classNames = "btn btn-info pull-right";
+    return this.get('loading') ? classNames + ' disabled' : classNames;
   }),
 
   /*--------------------------------------------------------------------------*/
@@ -82,34 +100,68 @@ export default Component.extend({
       /** this action function is called before jQuery val() is updated. */
       later(() => {
         this.set('text', text);
-        this.dnaSequenceInput(/*text*/);
+        // this.dnaSequenceInput(/*text*/);
       }, 500);
     },
 
     dnaSequenceInput(text, event) {
       dLog("dnaSequenceInput", this, text.length, event.keyCode);
       this.set('text', text);
-      throttle(this.get('dnaSequenceInputBound'), 2000);
+      // throttle(this.get('dnaSequenceInputBound'), 2000);
+    },
+
+    search() {
+      if (this.checkInputs()) {
+      let text = this.get('text');
+        this.dnaSequenceInput(text);
+      }
     }
 
   },
 
   /*--------------------------------------------------------------------------*/
 
+  checkInputs() {
+    let ok;
+    this.clearMsgs();
+
+    let datasetName = this.get('newDatasetName');
+    let parentName = this.get('selectedParent');
+    if (! parentName || ! parentName.length || (parentName === 'None')) {
+      this.set('nameWarning', 'Please select a reference genome to search');
+      ok = false;
+    } else if (this.get('addDataset') && ! (datasetName && datasetName.length)) {
+      this.set('nameWarning', 'Please enter name for the dataset to add containing the search results.o');
+      ok = false;
+    } else if (this.get('addDataset') && this.isDupName()) {
+      ok = false;
+    } else {
+      ok = true;
+    }
+    return ok;
+  },
+  inputsOK : computed('selectedParent', 'addDataset', 'newDatasetName', 'datasets.[]', function() {
+    return this.checkInputs();
+  }),
+  searchButtonDisabled : computed('inputsOK', 'isProcessing', function() {
+    return ! this.get('inputsOK') || this.get('isProcessing');
+  }),
+
   /** throttle depends on constant function  */
   dnaSequenceInputBound : computed(function() {
     return bind(this, this.dnaSequenceInput);
   }),
 
   dnaSequenceInput(rawText) {
-    rawText = this.get('text');
-    // dLog("dnaSequenceInput");
-
-    /*
-    let
-      text$ = $('textarea', this.element),
+    // dLog("dnaSequenceInput", rawText && rawText.length);
+    /** if the user has use paste or newline then .text is defined,
+     * otherwise use jQuery to get it from the textarea.
+     */
+    if (! rawText) {
+      let text$ = $('textarea', this.element);
       /** before textarea is created, .val() will be undefined. */
-      // rawText = text$.val();
+      rawText = text$.val();
+    }
       if (rawText)
       {
         let
@@ -136,7 +188,11 @@ export default Component.extend({
         promise.then(
           (data) => {
             dLog('dnaSequenceInput', data.features.length);
-            this.set('data', data.features); },
+            this.set('data', data.features);
+            if (this.get('addDataset') && this.get('replaceDataset')) {
+              this.unviewDataset(this.get('newDatasetName'));
+            }
+          },
           // copied from data-base.js - could be factored.
           (err, status) => {
             let errobj = err.responseJSON.error;
@@ -155,6 +211,24 @@ export default Component.extend({
 
         );
     }
+  },
+
+  /*--------------------------------------------------------------------------*/
+  /* copied from file-drop-zone.js, can factor if this is retained.  */
+
+  /** Unview the blocks of the dataset which has been replaced by successful upload.
+   */
+  unviewDataset(datasetName) {
+    let
+    store = this.get('apiServers').get('primaryServer').get('store'),
+    replacedDataset = store.peekRecord('dataset', datasetName),
+    viewedBlocks = replacedDataset.get('blocks').toArray().filterBy('isViewed'),
+    blockService = this.get('blockService'),
+    blockIds = viewedBlocks.map((b) => b.id);
+    dLog('unviewDataset', datasetName, blockIds);
+    blockService.setViewed(blockIds, false);
   }
 
+  /*--------------------------------------------------------------------------*/
+
 });

frontend/app/templates/components/panel/sequence-search.hbs

@@ -35,6 +35,18 @@
             placeholder="e.g. >BobWhite_c10015_641
 AGCTGGGTGTCGTTGATCTTCAGGTCCTTCTGGATGTACAGCGACGCTCC" }}
 
+          <div style="margin: 1em; overflow-y: auto;">
+            {{#elem/button-base
+               click=(action "search")
+               classNames=refreshClassNames
+               disabled=searchButtonDisabled
+               icon='refresh'
+               classColour="primary"
+            }}
+              <span>&nbsp; Search</span>
+            {{/elem/button-base}}
+          </div>
+
 
           <ul class="config-list">
 
@@ -77,6 +89,11 @@ AGCTGGGTGTCGTTGATCTTCAGGTCCTTCTGGATGTACAGCGACGCTCC" }}
 
               {{!-- copied from data-csv.hbs --}}
               {{#if this.addDataset}}
+                <span class="filter-group-col">
+                  {{input type="checkbox" name="replaceDataset" checked=replaceDataset }}
+                  <label>Replace Dataset</label>
+                </span>
+
                 <div id="new_dataset_options">
                 {{input 
                   id="dataset_new" 
@@ -87,6 +104,7 @@ AGCTGGGTGTCGTTGATCTTCAGGTCCTTCTGGATGTACAGCGACGCTCC" }}
                   disabled=isProcessing
                 }}
                 </div>
+
               {{/if}}
             </li>