sequence search : view added dataset

sequence-search.js : dnaSequenceInput() : after refreshDatasets, if viewDatasetFlag then viewDataset. block.js : getCountsForInterval() : handle interval undefined. sequence-search.hbs : add checkbox : viewDatasetFlag. mapview: add viewDataset() and pass to left-panel, which passes it to sequence-search. updateModel() : return datasetsTask.
plantinformatics · May 31, 2021 · 66d59ba · 66d59ba
1 parent 3b9e7ce
commit 66d59ba
Show file tree

Hide file tree

Showing 6 changed files with 57 additions and 2 deletions.
diff --git a/frontend/app/components/panel/sequence-search.js b/frontend/app/components/panel/sequence-search.js
@@ -205,7 +205,22 @@ export default Component.extend({
           /* On complete, trigger dataset list reload.
            * refreshDatasets is passed from controllers/mapview (updateModel ).
            */
-          promise.then(() => this.get('refreshDatasets')());
+          promise.then(() => {
+            const viewDataset = this.get('viewDatasetFlag');
+            let refreshed = this.get('refreshDatasets')();
+            if (viewDataset) {
+              refreshed
+                .then(() => {
+                  /** same as convertSearchResults2Json() in dnaSequenceSearch.bash and
+                   * backend/common/models/feature.js :  Feature.dnaSequenceSearch() */
+                  let
+                  datasetName = this.get('newDatasetName'),
+                  datasetNameFull=`${parent}.${datasetName}`;
+                  dLog(fnName, 'viewDataset', datasetNameFull);
+                  this.get('viewDataset')(datasetNameFull, viewDataset);
+                });
+            }
+          });
         }
 
         let searchData = sequenceSearchData.create({promise, seq, parent, searchType});

diff --git a/frontend/app/controllers/mapview.js b/frontend/app/controllers/mapview.js
@@ -79,6 +79,7 @@ export default Controller.extend(Evented, {
 
     /** Change the state of the named block to viewed.
      * If this block has a parent block, also add the parent.
+     * This is replaced by loadBlock().
      * @param mapName
      * (named map for consistency, but mapsToView really means block, and "name" is db ID)
      * Also @see components/record/entry-block.js : action get
@@ -238,6 +239,7 @@ export default Controller.extend(Evented, {
         this.get('block').getBlocksLimits();
       });
       }
+      return datasetsTask;
     }
   },
 
@@ -348,6 +350,37 @@ export default Controller.extend(Evented, {
     }
   },
 
+  /*--------------------------------------------------------------------------*/
+
+  /* copied from file-drop-zone.js, can factor if this is retained.  */
+  /** View/Unview the blocks of the given dataset.
+   * View is used to view a dataset added by sequence-sequence.
+   * Unview is used when the datasets has been replaced by successful upload.
+   * @param datasetName id
+   * @param view  true for view, false for unview
+   */
+  viewDataset(datasetName, view) {
+    let
+    store = this.get('apiServers').get('primaryServer').get('store'),
+    dataset = store.peekRecord('dataset', datasetName);
+    if (dataset) {
+      let
+      blocksToChange = dataset.get('blocks').toArray().filter((b) => b.get('isViewed') !== view),
+      blockService = this.get('block'),
+      blockIds = blocksToChange.map((b) => b.id);
+      dLog('viewDataset', datasetName, view, blockIds);
+      // blockService.setViewed(blockIds, view);
+      let loadBlock = this.actions.loadBlock.bind(this);
+      blocksToChange.forEach((b) => loadBlock(b));
+    } else {
+      dLog('viewDataset', datasetName, 'not found', view);
+    }
+  },
+
+
+  /*--------------------------------------------------------------------------*/
+
+
   /** Provide a class for the div which wraps the right panel.
    *
    * The class indicates which of the tabs in the right panel is currently

diff --git a/frontend/app/services/data/block.js b/frontend/app/services/data/block.js
@@ -458,7 +458,7 @@ export default Service.extend(Evented, {
               }
               let getCountsForInterval = (interval) => {
                 let countsP;
-                if (interval[0] === interval[1]) {
+                if (interval && (interval[0] === interval[1])) {
                   dLog('getCountsForInterval', interval);
                   countsP = Promise.resolve([]);
                 } else {

diff --git a/frontend/app/templates/components/panel/left-panel.hbs b/frontend/app/templates/components/panel/left-panel.hbs
@@ -24,6 +24,7 @@
                 datasets=datasets
                 view=view
                 refreshDatasets=refreshDatasets
+		viewDataset=viewDataset
             }}
       </tab.pane>
 

diff --git a/frontend/app/templates/components/panel/sequence-search.hbs b/frontend/app/templates/components/panel/sequence-search.hbs
@@ -97,6 +97,11 @@ AGCTGGGTGTCGTTGATCTTCAGGTCCTTCTGGATGTACAGCGACGCTCC" }}
                   <label>Replace Dataset</label>
                 </span>
 
+                <span class="filter-group-col">
+                  {{input type="checkbox" name="viewDatasetFlag" checked=viewDatasetFlag }}
+                  <label>View</label>
+                </span>
+
                 <div id="new_dataset_options">
                 {{input 
                   id="dataset_new" 

diff --git a/frontend/app/templates/mapview.hbs b/frontend/app/templates/mapview.hbs
@@ -12,6 +12,7 @@
     model=model
     datasets=datasets
     refreshDatasets=(action "updateModel")
+    viewDataset=(action this.viewDataset)
     selectedBlock=selectedBlock
     controls=controls
     isShowUnique=isShowUnique