-
Notifications
You must be signed in to change notification settings - Fork 56
Commit
This commit does not belong to any branch on this repository, and may belong to a fork outside of the repository.
Merge pull request #124 from martinghunt/report_ref_base_assembled_bug
Bug fix reporting ref_base_assembled for a partial gene assembly
- Loading branch information
Showing
7 changed files
with
890 additions
and
1 deletion.
There are no files selected for viewing
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,3 @@ | ||
>presence_absence1 | ||
ATGGATCGCGAAGCGATGACCCATGAAGCGACCGAACGCGCGAGCACCAACATTAGCCAT | ||
ATTAACGGCATTAGCGCGTGGGAAAGCATGGAATAA |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1 @@ | ||
presence_absence1 1 0 . . Generic description of presence_absence1 |
432 changes: 432 additions & 0 deletions
432
ariba/tests/data/cluster_test_full_run_partial_asmbly/reads_1.fq
Large diffs are not rendered by default.
Oops, something went wrong.
432 changes: 432 additions & 0 deletions
432
ariba/tests/data/cluster_test_full_run_partial_asmbly/reads_2.fq
Large diffs are not rendered by default.
Oops, something went wrong.
3 changes: 3 additions & 0 deletions
3
ariba/tests/data/cluster_test_full_run_partial_asmbly/references.fa
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,3 @@ | ||
>presence_absence1 | ||
ATGGATCGCGAAGCGATGACCCATGAAGCGACCGAACGCGCGAGCACCAACATTAGCCAT | ||
ATTAACGGCATTAGCGCGTGGGAAAGCATGGAATAA |