-
Notifications
You must be signed in to change notification settings - Fork 56
Commit
This commit does not belong to any branch on this repository, and may belong to a fork outside of the repository.
Merge pull request #279 from sanger-pathogens/cdhit_docker_fix_branch
Fix for issue #278 Version 3.0.3 of CARD breaks prepareref
- Loading branch information
Showing
32 changed files
with
243 additions
and
15 deletions.
There are no files selected for viewing
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
|
@@ -8,6 +8,7 @@ MAINTAINER [email protected] | |
ARG BOWTIE2_VERSION=2.2.9 | ||
ARG SPADES_VERSION=3.13.1 | ||
ARG ARIBA_TAG=master | ||
ARG ARIBA_BUILD_DIR=/ariba | ||
|
||
RUN apt-get -qq update && \ | ||
apt-get install --no-install-recommends -y \ | ||
|
@@ -27,10 +28,12 @@ RUN apt-get -qq update && \ | |
wget \ | ||
zlib1g-dev | ||
|
||
# Install bowtie | ||
RUN wget -q http://downloads.sourceforge.net/project/bowtie-bio/bowtie2/${BOWTIE2_VERSION}/bowtie2-${BOWTIE2_VERSION}-linux-x86_64.zip \ | ||
&& unzip bowtie2-${BOWTIE2_VERSION}-linux-x86_64.zip \ | ||
&& rm -f bowtie2-${BOWTIE2_VERSION}-linux-x86_64.zip | ||
|
||
# Install SPAdes | ||
RUN wget -q https://github.com/ablab/spades/releases/download/v${SPADES_VERSION}/SPAdes-${SPADES_VERSION}-Linux.tar.gz \ | ||
&& tar -zxf SPAdes-${SPADES_VERSION}-Linux.tar.gz \ | ||
&& rm -f SPAdes-${SPADES_VERSION}-Linux.tar.gz | ||
|
@@ -40,13 +43,15 @@ RUN wget -q https://github.com/ablab/spades/releases/download/v${SPADES_VERSION} | |
ENV ARIBA_BOWTIE2=$PWD/bowtie2-${BOWTIE2_VERSION}/bowtie2 ARIBA_CDHIT=cdhit-est MPLBACKEND="agg" | ||
ENV PATH=$PATH:$PWD/SPAdes-${SPADES_VERSION}-Linux/bin | ||
|
||
RUN cd /usr/local/bin && ln -s /usr/bin/python3 python && cd | ||
RUN ln -s -f /usr/bin/python3 /usr/local/bin/python | ||
|
||
RUN git clone https://github.com/sanger-pathogens/ariba.git \ | ||
&& cd ariba \ | ||
&& git checkout ${ARIBA_TAG} \ | ||
&& rm -rf .git \ | ||
# Install Ariba | ||
RUN mkdir -p $ARIBA_BUILD_DIR | ||
COPY . $ARIBA_BUILD_DIR | ||
RUN cd $ARIBA_BUILD_DIR \ | ||
&& python3 setup.py clean --all \ | ||
&& python3 setup.py test \ | ||
&& python3 setup.py install | ||
&& python3 setup.py install \ | ||
&& rm -rf $ARIBA_BUILD_DIR | ||
|
||
CMD ariba |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,17 @@ | ||
>noncoding1-toolong | ||
CTACTGATCATCTACTATCTGCATCGATGCCTGATCTA | ||
>noncoding2 | ||
CTACTGAT | ||
>cannot_make_into_a_gene | ||
AAAAAAAAAAAAAAAA | ||
>noncoding3-tooshort | ||
C | ||
>gene1 | ||
ATGGATCGTGAAGCGATGACCCATGAAGCGACCGAACGCTAA | ||
>noncoding4-toolong | ||
CTACTGATCATCTACTATCTG | ||
>noncoding5-tooshort | ||
CTCTC | ||
>gene2 | ||
ATGGATCGCGAAGCGATGACCCATGAAGCGACCGAACGCTAA | ||
|
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,8 @@ | ||
cannot_make_into_a_gene 1 0 . . . | ||
noncoding1-toolong 0 0 . . . | ||
noncoding2 0 0 C4T . . | ||
noncoding3-tooshort 0 0 C4T . . | ||
noncoding4-toolong 0 0 C4T . . | ||
noncoding5-tooshort 0 0 C4T . . | ||
gene1 1 0 . . . | ||
gene2 1 0 . . . |
2 changes: 1 addition & 1 deletion
2
ariba/tests/data/ref_preparer_test_run.out/01.filter.check_metadata.log
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -1 +1 @@ | ||
cannot_make_into_a_gene was removed because does not look like a gene, so removing its metadata | ||
cannot_make_into_a_gene was removed because it failed filtering checks, so removing its metadata |
Empty file.
Empty file.
3 changes: 3 additions & 0 deletions
3
ariba/tests/data/ref_preparer_test_run_noncoding_checks.out/00.info.txt
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,3 @@ | ||
input fasta file: /Users/kp11/workspace/applications/Ariba/ariba/ariba/tests/data/ref_preparer_test_run.in.4.fa | ||
input tsv file: /Users/kp11/workspace/applications/Ariba/ariba/ariba/tests/data/ref_preparer_test_run.in.4.tsv | ||
genetic_code 1 |
4 changes: 4 additions & 0 deletions
4
ariba/tests/data/ref_preparer_test_run_noncoding_checks.out/00.rename_info
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,4 @@ | ||
noncoding1-toolong noncoding1_toolong | ||
noncoding3-tooshort noncoding3_tooshort | ||
noncoding4-toolong noncoding4_toolong | ||
noncoding5-tooshort noncoding5_tooshort |
5 changes: 5 additions & 0 deletions
5
ariba/tests/data/ref_preparer_test_run_noncoding_checks.out/00.version_info.txt
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,5 @@ | ||
ARIBA run with this command: | ||
setup.py prepareref test | ||
from this directory: /Users/kp11/workspace/applications/Ariba/ariba | ||
|
||
|
3 changes: 3 additions & 0 deletions
3
ariba/tests/data/ref_preparer_test_run_noncoding_checks.out/01.filter.check_genes.log
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,3 @@ | ||
cannot_make_into_a_gene REMOVE Does not look like a gene (tried both strands and all reading frames) AAAAAAAAAAAAAAAA | ||
gene1 KEEP Made into gene. strand=+, frame=0 | ||
gene2 KEEP Made into gene. strand=+, frame=0 |
5 changes: 5 additions & 0 deletions
5
ariba/tests/data/ref_preparer_test_run_noncoding_checks.out/01.filter.check_metadata.log
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,5 @@ | ||
cannot_make_into_a_gene was removed because it failed filtering checks, so removing its metadata | ||
noncoding1_toolong was removed because it failed filtering checks, so removing its metadata | ||
noncoding3_tooshort was removed because it failed filtering checks, so removing its metadata | ||
noncoding4_toolong was removed because it failed filtering checks, so removing its metadata | ||
noncoding5_tooshort was removed because it failed filtering checks, so removing its metadata |
3 changes: 3 additions & 0 deletions
3
ariba/tests/data/ref_preparer_test_run_noncoding_checks.out/01.filter.check_metadata.tsv
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,3 @@ | ||
gene1 1 0 . . . | ||
gene2 1 0 . . . | ||
noncoding2 0 0 C4T . . |
4 changes: 4 additions & 0 deletions
4
ariba/tests/data/ref_preparer_test_run_noncoding_checks.out/01.filter.check_noncoding.log
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,4 @@ | ||
noncoding1_toolong REMOVE Too long. Length: 38 | ||
noncoding3_tooshort REMOVE Too short. Length: 1 | ||
noncoding4_toolong REMOVE Too long. Length: 21 | ||
noncoding5_tooshort REMOVE Too short. Length: 5 |
6 changes: 6 additions & 0 deletions
6
ariba/tests/data/ref_preparer_test_run_noncoding_checks.out/02.cdhit.all.fa
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,6 @@ | ||
>gene1 | ||
ATGGATCGTGAAGCGATGACCCATGAAGCGACCGAACGCTAA | ||
>gene2 | ||
ATGGATCGCGAAGCGATGACCCATGAAGCGACCGAACGCTAA | ||
>noncoding2 | ||
CTACTGAT |
Binary file added
BIN
+72 Bytes
ariba/tests/data/ref_preparer_test_run_noncoding_checks.out/02.cdhit.clusters.pickle
Binary file not shown.
1 change: 1 addition & 0 deletions
1
ariba/tests/data/ref_preparer_test_run_noncoding_checks.out/02.cdhit.clusters.tsv
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1 @@ | ||
cluster gene1 gene2 |
4 changes: 4 additions & 0 deletions
4
ariba/tests/data/ref_preparer_test_run_noncoding_checks.out/02.cdhit.gene.fa
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,4 @@ | ||
>gene1 | ||
ATGGATCGTGAAGCGATGACCCATGAAGCGACCGAACGCTAA | ||
>gene2 | ||
ATGGATCGCGAAGCGATGACCCATGAAGCGACCGAACGCTAA |
Empty file.
2 changes: 2 additions & 0 deletions
2
ariba/tests/data/ref_preparer_test_run_noncoding_checks.out/02.cdhit.noncoding.fa
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,2 @@ | ||
>noncoding2 | ||
CTACTGAT |
Empty file.
Empty file.
10 changes: 10 additions & 0 deletions
10
ariba/tests/data/reference_data_remove_bad_noncoding.in.fa
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,10 @@ | ||
>noncoding1 | ||
AAAA | ||
>noncoding2 | ||
GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG | ||
>noncoding3 | ||
CCCCCC | ||
>noncoding4 | ||
TTTTTTTTTTTTTTT | ||
>noncoding5 | ||
AAAAAAAAAAAA |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,5 @@ | ||
noncoding1 0 0 . . . | ||
noncoding2 0 0 . . . | ||
noncoding3 0 0 . . . | ||
noncoding4 0 0 . . . | ||
noncoding5 0 0 . . . |
2 changes: 2 additions & 0 deletions
2
ariba/tests/data/reference_data_test_remove_bad_noncoding.log
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,2 @@ | ||
noncoding1 REMOVE Too short. Length: 4 | ||
noncoding2 REMOVE Too long. Length: 133 |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Oops, something went wrong.